ID: 1133324259 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:4933955-4933977 |
Sequence | AGGATTAAATGAAATAATGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1664 | |||
Summary | {0: 3, 1: 20, 2: 108, 3: 369, 4: 1164} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1133324259_1133324260 | -6 | Left | 1133324259 | 16:4933955-4933977 | CCTGCATTATTTCATTTAATCCT | 0: 3 1: 20 2: 108 3: 369 4: 1164 |
||
Right | 1133324260 | 16:4933972-4933994 | AATCCTGAGCCAACATCGCCAGG | 0: 1 1: 0 2: 0 3: 1 4: 65 |
||||
1133324259_1133324266 | 24 | Left | 1133324259 | 16:4933955-4933977 | CCTGCATTATTTCATTTAATCCT | 0: 3 1: 20 2: 108 3: 369 4: 1164 |
||
Right | 1133324266 | 16:4934002-4934024 | CGTGCTTATTCCCATCCCACAGG | 0: 1 1: 0 2: 0 3: 2 4: 66 |
||||
1133324259_1133324262 | -2 | Left | 1133324259 | 16:4933955-4933977 | CCTGCATTATTTCATTTAATCCT | 0: 3 1: 20 2: 108 3: 369 4: 1164 |
||
Right | 1133324262 | 16:4933976-4933998 | CTGAGCCAACATCGCCAGGCAGG | 0: 1 1: 0 2: 0 3: 9 4: 189 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1133324259 | Original CRISPR | AGGATTAAATGAAATAATGC AGG (reversed) | Intronic | ||