ID: 1133324259

View in Genome Browser
Species Human (GRCh38)
Location 16:4933955-4933977
Sequence AGGATTAAATGAAATAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1664
Summary {0: 3, 1: 20, 2: 108, 3: 369, 4: 1164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133324259_1133324260 -6 Left 1133324259 16:4933955-4933977 CCTGCATTATTTCATTTAATCCT 0: 3
1: 20
2: 108
3: 369
4: 1164
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65
1133324259_1133324266 24 Left 1133324259 16:4933955-4933977 CCTGCATTATTTCATTTAATCCT 0: 3
1: 20
2: 108
3: 369
4: 1164
Right 1133324266 16:4934002-4934024 CGTGCTTATTCCCATCCCACAGG 0: 1
1: 0
2: 0
3: 2
4: 66
1133324259_1133324262 -2 Left 1133324259 16:4933955-4933977 CCTGCATTATTTCATTTAATCCT 0: 3
1: 20
2: 108
3: 369
4: 1164
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133324259 Original CRISPR AGGATTAAATGAAATAATGC AGG (reversed) Intronic