ID: 1133324260

View in Genome Browser
Species Human (GRCh38)
Location 16:4933972-4933994
Sequence AATCCTGAGCCAACATCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133324256_1133324260 1 Left 1133324256 16:4933948-4933970 CCTTTCCCCTGCATTATTTCATT 0: 1
1: 0
2: 5
3: 73
4: 633
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65
1133324258_1133324260 -5 Left 1133324258 16:4933954-4933976 CCCTGCATTATTTCATTTAATCC 0: 4
1: 9
2: 104
3: 337
4: 1082
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65
1133324254_1133324260 25 Left 1133324254 16:4933924-4933946 CCTGCGGCCGCTTATCATTCACA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65
1133324257_1133324260 -4 Left 1133324257 16:4933953-4933975 CCCCTGCATTATTTCATTTAATC 0: 1
1: 1
2: 10
3: 115
4: 690
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65
1133324259_1133324260 -6 Left 1133324259 16:4933955-4933977 CCTGCATTATTTCATTTAATCCT 0: 3
1: 20
2: 108
3: 369
4: 1164
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65
1133324255_1133324260 18 Left 1133324255 16:4933931-4933953 CCGCTTATCATTCACAACCTTTC 0: 1
1: 0
2: 2
3: 11
4: 227
Right 1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133324260 Original CRISPR AATCCTGAGCCAACATCGCC AGG Intronic
901476767 1:9495230-9495252 GGTCCTGAGCCACCATCCCCAGG - Intergenic
903622344 1:24707053-24707075 AAGCATGAGCCACCATTGCCTGG + Intergenic
906950255 1:50329327-50329349 AATCCTGCCCCAAAATAGCCTGG + Intergenic
912936490 1:114007665-114007687 AACCTTGAGCCCACATCCCCTGG - Intergenic
918764723 1:188465230-188465252 AATCCTGATCCAACACCCACTGG - Intergenic
922819327 1:228473255-228473277 AGGCCTGAGCCACCATGGCCAGG - Intergenic
1065921493 10:30397355-30397377 CATCCTGACCCAAGATCCCCAGG - Intergenic
1069614123 10:69795741-69795763 TATCCTGAGCCAGCATGGTCAGG - Intergenic
1073069457 10:100784020-100784042 AATCCTGATCCACCAGCCCCTGG + Intronic
1073180850 10:101582241-101582263 AATCCTGAGCCAGCCTTGCGTGG + Intronic
1073363200 10:102917147-102917169 AAGCGTGAGCCACCAACGCCCGG + Intergenic
1074555546 10:114485834-114485856 AATCTTGAGCCAAGATTTCCAGG - Intronic
1077559994 11:3254168-3254190 CATCCTGAGTCAACACCGCTGGG - Intergenic
1077565887 11:3299971-3299993 CATCCTGAGTCAACACCGCTGGG - Intergenic
1079005537 11:16789091-16789113 CATACTGAGCCAAGATCTCCAGG + Exonic
1080427506 11:32169658-32169680 AGTCCTGGGCCATCATCCCCTGG - Intergenic
1096917090 12:55045022-55045044 AATCCTGAGGAAAAATTGCCAGG - Intergenic
1097159939 12:57038973-57038995 ACTCCTCATCCAACATGGCCAGG + Exonic
1101409889 12:104458660-104458682 ATTTCTGAGCCAACGTGGCCCGG - Intronic
1106756150 13:32824841-32824863 AAACCAGAGCAAAGATCGCCCGG - Intergenic
1107661440 13:42643354-42643376 GCTCCTGAGCCCACATCACCAGG - Intergenic
1114270935 14:21099514-21099536 AGTGCTGTGCCAACATCGGCGGG - Intronic
1124595602 15:31089269-31089291 AATGGTGGGCCAACATTGCCCGG + Intronic
1128024714 15:64425803-64425825 AGGCCTGAGCCACCAGCGCCCGG - Intronic
1129477840 15:75798132-75798154 CATCATGAGCCAAGATCCCCAGG + Intergenic
1131143631 15:89998281-89998303 TCTCCTGAGCAAACATAGCCAGG + Intergenic
1133324260 16:4933972-4933994 AATCCTGAGCCAACATCGCCAGG + Intronic
1134227042 16:12399346-12399368 AATCCTGAACAAAAATCGGCTGG - Intronic
1139970185 16:70769454-70769476 AAACCAGAGCCAACATGCCCGGG - Intronic
1140164273 16:72533216-72533238 AATTCTGAGCCAATATCACATGG - Intergenic
1161444690 19:4311538-4311560 AGTCGTGAGCCACCATGGCCCGG - Intronic
932157213 2:69428663-69428685 AATCCTTATCTAACATTGCCAGG + Intronic
934892546 2:98083344-98083366 ACTCCTGTGCCCACATAGCCAGG + Intergenic
941001278 2:160205775-160205797 AATCCTGAGTCAACCTGGCTGGG + Intronic
942358973 2:175151767-175151789 AATCCAGAACCATGATCGCCTGG + Intronic
945086154 2:206134696-206134718 AAGCATGAGCCAACCTTGCCTGG - Intronic
945298041 2:208190454-208190476 AATCCTGAAGAAACATCACCTGG + Intergenic
1172686883 20:36762386-36762408 AGGCCTGAGCCACCAACGCCCGG + Intronic
1183173627 22:36205774-36205796 CATCCTGAGCAAACATCGCTGGG + Intergenic
1183179732 22:36252058-36252080 CATCCTGAGCAAACATCTCTGGG - Intergenic
950406448 3:12808101-12808123 GTTCCTGAGCCCACATCCCCGGG - Intronic
950503394 3:13378026-13378048 AGTCCTGAGCTGACCTCGCCAGG + Intronic
950503419 3:13378227-13378249 AGTCCTGAGCTGACCTCGCCAGG + Intronic
952209686 3:31217172-31217194 AGTCCTGAGCCAGTACCGCCTGG + Intergenic
953395482 3:42566195-42566217 CATCCAGAGCCCACATCACCAGG + Intronic
967484475 3:190014640-190014662 AATCTTGAGCCCACATCTTCTGG + Intronic
974066080 4:57078765-57078787 AATCCAGAGCCTACAGAGCCCGG + Intronic
982494189 4:156069575-156069597 AATCCAGAGCCAATTTTGCCAGG + Intergenic
982503496 4:156189503-156189525 AATCTTGAGCCAACTTCCTCTGG - Intergenic
996675636 5:126171950-126171972 ACTCATGAGCCCACATCACCAGG + Intergenic
999974386 5:156896465-156896487 AAGACTCAGCCAACATCACCAGG + Intergenic
1008732191 6:54495702-54495724 ACTCCTGAGCCAATCTTGCCTGG + Intergenic
1016011590 6:139142667-139142689 AGTCGTGAGCCACCATTGCCTGG - Intronic
1017055455 6:150431913-150431935 AATGCAGAGCCAAAATTGCCCGG + Intergenic
1017763049 6:157585779-157585801 GATCCAGAGCCAACCTCGCATGG - Intronic
1018568544 6:165183585-165183607 GATCCTGAGCCAGAATCCCCTGG - Intergenic
1020154671 7:5712945-5712967 GATCCTGAGACAACATAGCAAGG + Intronic
1026145701 7:67744615-67744637 GACCCTGGGCCAACATCTCCCGG - Intergenic
1031311033 7:120197414-120197436 AACCATGAGCCAATATGGCCTGG - Intergenic
1042742103 8:72061365-72061387 AATCTTGAGCCTACATCCACTGG + Intronic
1048654404 8:136519594-136519616 AATCCTGCCCCATCTTCGCCTGG + Intergenic
1056955847 9:91080449-91080471 AATCCTGAGGCACCATCAGCAGG + Intergenic
1059460330 9:114425428-114425450 CAGCCTGAGCCCACATCGGCTGG - Intronic
1060939755 9:127536476-127536498 AATCCTGAAGCAACAATGCCGGG - Intronic
1062176513 9:135166179-135166201 AATAATGAGGCCACATCGCCTGG + Intergenic
1192844694 X:74894011-74894033 AAGCGTGAGCCACCATAGCCTGG - Intronic
1197762415 X:130037192-130037214 AGTCCTGAGCCACAATTGCCAGG - Intronic