ID: 1133324262

View in Genome Browser
Species Human (GRCh38)
Location 16:4933976-4933998
Sequence CTGAGCCAACATCGCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133324257_1133324262 0 Left 1133324257 16:4933953-4933975 CCCCTGCATTATTTCATTTAATC 0: 1
1: 1
2: 10
3: 115
4: 690
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324254_1133324262 29 Left 1133324254 16:4933924-4933946 CCTGCGGCCGCTTATCATTCACA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324255_1133324262 22 Left 1133324255 16:4933931-4933953 CCGCTTATCATTCACAACCTTTC 0: 1
1: 0
2: 2
3: 11
4: 227
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324258_1133324262 -1 Left 1133324258 16:4933954-4933976 CCCTGCATTATTTCATTTAATCC 0: 4
1: 9
2: 104
3: 337
4: 1082
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324259_1133324262 -2 Left 1133324259 16:4933955-4933977 CCTGCATTATTTCATTTAATCCT 0: 3
1: 20
2: 108
3: 369
4: 1164
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324256_1133324262 5 Left 1133324256 16:4933948-4933970 CCTTTCCCCTGCATTATTTCATT 0: 1
1: 0
2: 5
3: 73
4: 633
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133324262 Original CRISPR CTGAGCCAACATCGCCAGGC AGG Intronic
900337525 1:2171987-2172009 CTGCGCCAACAGCTCCAGCCTGG - Intronic
902234919 1:15051090-15051112 CTGAGCAGACATCGGAAGGCTGG - Intronic
902357690 1:15917670-15917692 GTGAGCCACCATGCCCAGGCTGG + Intronic
904476980 1:30771669-30771691 CAGAGCCAAGATGGTCAGGCAGG + Intergenic
904818533 1:33223608-33223630 GTGAGCCACCATGGCCAGCCTGG - Intergenic
905069414 1:35212233-35212255 CTGAGCCACCATATCCAGCCTGG + Intergenic
905417422 1:37813581-37813603 CTAAGCCAACAGTGTCAGGCAGG - Exonic
905540692 1:38758088-38758110 GTGAGCCAACATACCCAGCCGGG - Intergenic
908031020 1:59999936-59999958 CTTCCCCAACAGCGCCAGGCTGG + Intronic
908498458 1:64718973-64718995 ATGAGCCACCACGGCCAGGCAGG - Intergenic
909605666 1:77505844-77505866 GTGAGCCAAGATCGGCAGCCTGG + Intronic
910910134 1:92224796-92224818 GTGAGCCGAGATCGCCAGCCTGG - Intronic
911139043 1:94477530-94477552 GTGAGCCAAGATCTCCAGCCTGG + Intronic
913977528 1:143474802-143474824 ATGAGCCACCATGCCCAGGCTGG - Intergenic
914071933 1:144300433-144300455 ATGAGCCACCATGCCCAGGCTGG - Intergenic
914107222 1:144665923-144665945 ATGAGCCACCATGCCCAGGCTGG + Intergenic
914253018 1:145937439-145937461 CTGAGCCACCATGCCCAGCCAGG + Intronic
920911586 1:210222842-210222864 CTGAGCCAACACAGCATGGCAGG + Intergenic
920916016 1:210258618-210258640 CAGAGCCAAGATCAGCAGGCAGG + Intergenic
1063421276 10:5914534-5914556 CTGAGCAAACATCACAATGCTGG - Intronic
1064055606 10:12094617-12094639 ATGAGCCACCATGCCCAGGCAGG + Intronic
1064463408 10:15556308-15556330 CTGAGCCACCATACCCAGCCAGG + Intronic
1065013637 10:21441891-21441913 CTGAGCCACCATCCCCAGCCAGG + Intergenic
1067350716 10:45473371-45473393 CAGAGCCTACAGAGCCAGGCTGG + Intronic
1067575269 10:47404670-47404692 CTGAGCCAGCACAGCAAGGCTGG - Intergenic
1067662168 10:48244265-48244287 GTGAGCCACCATGGCCAGCCAGG + Intronic
1067714202 10:48673981-48674003 GTGAGCCGAAATCGCCAGCCTGG - Intergenic
1072235920 10:93453622-93453644 ATGAGCCACCATTCCCAGGCTGG - Intronic
1072993828 10:100225129-100225151 GTGAGCCAACATGCCCAGCCTGG + Intronic
1074429288 10:113379852-113379874 CTGAGCAAACAAAGCCAGACTGG - Intergenic
1077353351 11:2103230-2103252 CTGACCCACCATGGCCAGTCTGG + Intergenic
1078316607 11:10298573-10298595 TTGAGCAAACATCACCAGGCAGG + Intergenic
1080016773 11:27516025-27516047 ATGAGCCAACATGCCCAGCCTGG - Intergenic
1080493154 11:32789486-32789508 CTGAGCCAACAACCCCAGCCTGG - Intronic
1080649126 11:34209061-34209083 CTGAGCCACCACGGCCAGCCAGG - Intronic
1083263697 11:61536518-61536540 CTGAGCCAGGATCTCAAGGCTGG - Intronic
1084097450 11:66920980-66921002 GTGAGCCGAGATCTCCAGGCTGG + Intronic
1084450111 11:69231777-69231799 CCGAGCCCACGTGGCCAGGCTGG + Intergenic
1085309408 11:75507284-75507306 CTGGGCCAAGAACCCCAGGCTGG + Intronic
1085336545 11:75701145-75701167 CTGAGCCAGCATCACTAGGGCGG + Intergenic
1086549500 11:88039667-88039689 TTGAGCCTACCTCGCCAGTCAGG - Intergenic
1086693272 11:89813615-89813637 CTGAGCCACCACGCCCAGGCTGG - Intergenic
1088302507 11:108374062-108374084 CTGAGCCTACAGAGGCAGGCAGG - Intronic
1091789753 12:3265009-3265031 CTGGACCAACACCACCAGGCTGG - Intronic
1093411246 12:18870046-18870068 GTGAGCCACCATCCCCAGCCAGG - Intergenic
1094555951 12:31500395-31500417 GTGAGCCAACATGCCCAGCCAGG - Intronic
1101409888 12:104458656-104458678 CTGAGCCAACGTGGCCCGGCAGG - Intronic
1102963923 12:117111900-117111922 CTGAGTCAGCGTGGCCAGGCAGG - Intergenic
1104500970 12:129285115-129285137 CTGAGTCAACATCCCCAAGAGGG + Intronic
1104846097 12:131847722-131847744 CACAGCGAACATCACCAGGCAGG - Intronic
1105001923 12:132695638-132695660 GCGAGCCAACATAGCTAGGCGGG + Intronic
1105221806 13:18336590-18336612 ATGAGCCACCATGCCCAGGCTGG + Intergenic
1110416644 13:75260761-75260783 ATGAGCCACCATGCCCAGGCTGG - Intergenic
1110652213 13:77954787-77954809 GTGAGCCAACATGCCCAGCCAGG + Intergenic
1113223577 13:108133828-108133850 CTTAGCCAGCAAGGCCAGGCAGG - Intergenic
1116873903 14:50092668-50092690 ATGAGCCACCATGCCCAGGCTGG - Intergenic
1117227688 14:53679995-53680017 CAGAGTCAACATCTCCAGGGTGG + Intergenic
1117369599 14:55064274-55064296 CTGAGCCACCATGCCCAGCCAGG + Intronic
1120882679 14:89426503-89426525 CTGAGCCACCATGCCCGGGCAGG + Intronic
1121209103 14:92193433-92193455 CTTACCCAACATTGCAAGGCTGG + Intergenic
1123056995 14:105575408-105575430 CTGAGCCAGCCTGGCCACGCTGG - Intergenic
1123081215 14:105696377-105696399 CTGAGCCAGCCTGGCCACGCTGG + Intergenic
1124482006 15:30087083-30087105 GTGAGCCTTCATCCCCAGGCTGG - Intronic
1124488464 15:30139183-30139205 GTGAGCCTTCATCCCCAGGCTGG - Intronic
1124543551 15:30608155-30608177 GTGAGCCTTCATCCCCAGGCTGG - Intronic
1124755065 15:32399139-32399161 GTGAGCCTTCATCCCCAGGCTGG + Intronic
1126366145 15:47896504-47896526 CTGAGCCATCATAGACAGCCAGG + Intergenic
1130005522 15:80093245-80093267 GTGAGCCACCATGCCCAGGCAGG + Intronic
1130159038 15:81380660-81380682 CTGAGCTAACATAGCTAAGCTGG + Intergenic
1131955171 15:97727903-97727925 GTGAGCCACCACAGCCAGGCTGG - Intergenic
1131981593 15:97999805-97999827 ATGAGCCAACACCCCCAGCCTGG - Intergenic
1132395008 15:101465978-101466000 CTGATCCAACAACGCCAGCAAGG + Intronic
1132724278 16:1332160-1332182 CTGACCCAGCACAGCCAGGCCGG - Intergenic
1133175312 16:4010106-4010128 CTGAGCCAACAGCACCTTGCAGG - Intronic
1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG + Intronic
1133797888 16:9061272-9061294 GTGAGCCACCATCTCCAGCCTGG + Intergenic
1134129890 16:11642085-11642107 CTGAGCCAACACAGCAAGTCAGG - Intergenic
1136255099 16:29033354-29033376 GTGAGCCACCATGCCCAGGCGGG + Intergenic
1137495528 16:48966573-48966595 CTTTCCCAACATCGCCTGGCAGG + Intergenic
1140394550 16:74615468-74615490 GTGAGCCAAGATCTCCAGCCTGG + Intergenic
1141407636 16:83808043-83808065 CTGAGACATCACCGCCAAGCTGG + Exonic
1141691683 16:85600303-85600325 CTGTGCCCAAATGGCCAGGCAGG + Intergenic
1143419911 17:6780684-6780706 CTGGGCCAAGCTGGCCAGGCAGG + Exonic
1144472725 17:15559106-15559128 ATGAGCCACCATGCCCAGGCTGG + Intronic
1144716050 17:17436635-17436657 CTGAGCCACCATGCCCAGCCCGG + Intergenic
1144923755 17:18785589-18785611 ATGAGCCACCATGCCCAGGCTGG - Intronic
1146555174 17:33816992-33817014 CTGAGCTCACACCGCCTGGCAGG + Intronic
1148245193 17:46025705-46025727 CTGAGCCCACAGCAGCAGGCTGG + Exonic
1148539071 17:48465462-48465484 ATGAGCCACCATGCCCAGGCAGG - Intergenic
1149868271 17:60162374-60162396 CAGAGCCACCATCCCCAGGGTGG - Intronic
1151294483 17:73174441-73174463 GTGAGCCACCATCCCCAGCCCGG - Intergenic
1151347224 17:73509505-73509527 ATGAGCCACCATGGCCAGCCTGG - Intronic
1151624874 17:75270582-75270604 CTGGGCCAGCAACGTCAGGCCGG - Intronic
1152555353 17:81050215-81050237 CTGAGCCAACATTGTAAGGGGGG - Intronic
1152855658 17:82663598-82663620 CAGAGCCAGCAGCCCCAGGCTGG + Intronic
1157260897 18:46174589-46174611 CGGAGCCAACTCCGCCGGGCCGG - Intronic
1158512145 18:58100133-58100155 CTGAGCCCACAGCAGCAGGCAGG - Intronic
1158928365 18:62295292-62295314 GTGAGCCACCATCCCCAGCCTGG + Intronic
1159274150 18:66193799-66193821 CTAAGCCAGTATAGCCAGGCAGG + Intergenic
1160059660 18:75517571-75517593 CTGTGCCCACATCCACAGGCTGG - Intergenic
1160521271 18:79509483-79509505 CTGAGGAAACATCACCGGGCCGG - Intronic
1161567353 19:5011135-5011157 CTGAGCCCAGATCGCCCTGCAGG - Intronic
1163434113 19:17284975-17284997 GTGAGCCACCATGGCCAGCCGGG - Intronic
1164894083 19:31854324-31854346 CTGAGCCACCATGCCCAGCCAGG + Intergenic
1165732267 19:38153376-38153398 AAGAGCCCACATGGCCAGGCGGG + Intronic
1166895751 19:46021035-46021057 CTCAGCCACCATCGCCAAGCGGG + Intronic
1168335319 19:55593839-55593861 GTGAGCCACCATGGCCAGCCAGG - Intronic
925718644 2:6807686-6807708 CTGAGCGACCCTCACCAGGCAGG - Intergenic
926025278 2:9537674-9537696 GTGAGCCGAGATCGCCAGCCTGG + Intronic
926291872 2:11538170-11538192 CTGCACCTTCATCGCCAGGCAGG - Intronic
927681912 2:25145287-25145309 GTGAGCCACCATCCCCAGCCAGG - Intronic
930014753 2:46962667-46962689 CCGAGACACCATGGCCAGGCAGG - Intronic
931197904 2:60070330-60070352 TTAAGCAAACATAGCCAGGCTGG + Intergenic
932097420 2:68863949-68863971 CTGTTCCAGCATCTCCAGGCAGG - Intergenic
934182234 2:89635798-89635820 GTGAGCCACCATGCCCAGGCTGG - Intergenic
934292530 2:91710007-91710029 GTGAGCCACCATGCCCAGGCTGG - Intergenic
935445827 2:103155545-103155567 CTTAGCCAGCATCGCCAGCTCGG + Intergenic
936789384 2:116133074-116133096 ATGAGCCACCCGCGCCAGGCCGG + Intergenic
936992983 2:118385871-118385893 CTGAGCCAGCCAGGCCAGGCAGG - Intergenic
948643745 2:239391132-239391154 CTGAGCCACCATCACGAGCCGGG + Intronic
948792490 2:240386201-240386223 CTCAGGCAAAATGGCCAGGCAGG - Intergenic
1169200151 20:3705363-3705385 CTGAGAAAACAGAGCCAGGCAGG + Intronic
1171364859 20:24616837-24616859 CTGAGCTACTGTCGCCAGGCAGG + Intronic
1172241882 20:33418508-33418530 ATGAGCCAACATGCCCAGCCTGG - Intronic
1173458339 20:43221878-43221900 CTCAGCCACCTTCTCCAGGCAGG + Intergenic
1174539261 20:51276199-51276221 CTCAGCCAGCTTCGGCAGGCAGG - Intergenic
1175616486 20:60404445-60404467 ATGAGCCACCATCGCTAGCCAGG - Intergenic
1176097834 20:63352416-63352438 CTGAGCCAACACCGCCGGCTGGG + Intronic
1176113120 20:63419475-63419497 CTGAGCCCGCACCGCCAGGGCGG + Intronic
1176204880 20:63882897-63882919 CTGAGCCCTGATCTCCAGGCAGG - Intronic
1176668529 21:9710055-9710077 CCGAGCCACCATGCCCAGGCAGG + Intergenic
1176730239 21:10487440-10487462 ATGAGCCACCATGCCCAGGCTGG + Intergenic
1180115986 21:45705357-45705379 CTGTGCCCACATCTCCAGTCTGG - Intronic
1181154808 22:20912906-20912928 ATGAGCCAACATGCCCAGCCTGG + Intergenic
1181836924 22:25618053-25618075 GTGAGCCAACATGCCCAGCCAGG + Intronic
1182545572 22:31074101-31074123 GTGAGCCACCATGCCCAGGCAGG - Intronic
1182749749 22:32632148-32632170 CTGCGCCCATATCACCAGGCAGG + Intronic
954698469 3:52439835-52439857 CTGAGCCAGGGTGGCCAGGCTGG - Intronic
954719906 3:52552754-52552776 CTGAGCCAATAAGACCAGGCTGG - Intronic
955464768 3:59225375-59225397 CTTACCCAACATAGCAAGGCAGG - Intergenic
958905756 3:99940543-99940565 CTGAGCCAACACCAGAAGGCAGG + Intronic
959170697 3:102840814-102840836 CTTACCCAACATAGCAAGGCAGG - Intergenic
962063829 3:131958712-131958734 GTGAGCCAAGATCGCCTGACAGG - Intronic
962587253 3:136854553-136854575 CATATCCATCATCGCCAGGCTGG - Exonic
964695226 3:159500429-159500451 GTGAGCCAACATGCCCAGCCTGG - Intronic
965837029 3:172864028-172864050 GTGAGCCACCATCCCCAGCCTGG + Intergenic
966308559 3:178566457-178566479 CTGAGCTAACATTGCCAAGTAGG - Intronic
968531585 4:1094639-1094661 CGGAGCCAGCATTGCCATGCAGG + Intronic
969276655 4:6140360-6140382 CTGAGCCAGCCTCGCCACGTGGG - Intronic
970427977 4:15963070-15963092 CTGACCCAAAGTCCCCAGGCAGG + Exonic
976756180 4:88500220-88500242 CTGGGCCGACTTGGCCAGGCTGG + Intronic
977220048 4:94327634-94327656 CTGTGGCAACAGCCCCAGGCAGG + Intronic
978861831 4:113459680-113459702 GTGAGCCAAGATCGCAAGCCTGG - Intronic
985406251 4:189641476-189641498 CCGAGCCACCATGCCCAGGCAGG - Intergenic
985552023 5:538578-538600 CTGAGGCGGCATCGTCAGGCAGG - Intergenic
985788343 5:1911605-1911627 CTGAGCCCACTTTGCAAGGCTGG + Intergenic
989643407 5:43604111-43604133 CTGAGCCAGCTTCGGCTGGCAGG - Intronic
990331416 5:54729785-54729807 GTGAGCCACCACAGCCAGGCTGG + Intergenic
997822431 5:137078196-137078218 CTGAGCCCACATATCCAGGCTGG - Intronic
998558182 5:143146461-143146483 CTGAGGCCACATAGCCAGTCAGG + Intronic
1000515315 5:162231517-162231539 ATGAGCCACCATGGCCAGTCTGG + Intergenic
1004885497 6:20047941-20047963 ATGAGCCACCATGGCCAGCCTGG - Intergenic
1005380423 6:25228731-25228753 CTGAGCCCACAGAGCTAGGCGGG - Intergenic
1006403003 6:33828717-33828739 CTCAGCCTACATTGCCAGGCAGG + Intergenic
1006697731 6:35945626-35945648 CAGAGCCAAGATGACCAGGCAGG + Intronic
1009164515 6:60324732-60324754 GTGAGCCACCATGCCCAGGCTGG + Intergenic
1009626446 6:66143270-66143292 CTGAGCCAAAATTGCCATACAGG - Intergenic
1012190166 6:96270283-96270305 CTGAGCAAACAAGGCCAGTCAGG - Intergenic
1013247786 6:108303327-108303349 GTGAGCCAACATGCCCAGCCTGG + Intronic
1016955250 6:149620574-149620596 GTGAGCCAACATGCCCAGCCAGG + Intronic
1019572269 7:1718765-1718787 CTGAACCAACACGGCCAGGGAGG - Intronic
1020283092 7:6660910-6660932 ATGAGCCAACATAACCAGCCCGG - Intergenic
1022173289 7:27849806-27849828 CGGAGCCCACATCGCCATCCAGG + Intronic
1023440141 7:40176915-40176937 GTGAGCCAAGATCGCAAGCCTGG + Intronic
1031548828 7:123083874-123083896 CTTACCCAACCTCGCAAGGCAGG - Intergenic
1034599333 7:152234103-152234125 GTGAGCCACCATGCCCAGGCTGG - Intronic
1037894229 8:22641246-22641268 CTGAGCTAACCTCGCCAGCCTGG - Intronic
1038193605 8:25346177-25346199 CTGAGCCACCATGCCCAGTCAGG - Intronic
1038337283 8:26655679-26655701 CCGTGCCAACATCACCAGCCTGG + Exonic
1038565956 8:28620213-28620235 CTGATCCCACAGTGCCAGGCAGG + Intronic
1041053209 8:53957375-53957397 GTGAGCCACCATACCCAGGCAGG + Intronic
1042541233 8:69908855-69908877 CTTACCCAACATAGCAAGGCAGG + Intergenic
1046155608 8:110286053-110286075 ATGAGCCAACATGCCCAGCCTGG + Intergenic
1048952996 8:139511465-139511487 CTGAGCCCACATATCCAGACTGG - Intergenic
1049218163 8:141417221-141417243 CTGAGGTAACACCGGCAGGCAGG - Intronic
1050546623 9:6715307-6715329 ATGAGCCAAGATCGCCCCGCTGG + Intergenic
1052000843 9:23278159-23278181 GTGAGCCAAGATTGCCAGCCTGG + Intergenic
1056730083 9:89157906-89157928 GTGAGCCACCATGCCCAGGCTGG + Intronic
1062490229 9:136801421-136801443 ATGAGCCACCATGCCCAGGCCGG - Intronic
1062514638 9:136926449-136926471 CTGTGCCACCTTGGCCAGGCTGG + Exonic
1203584040 Un_KI270746v1:46633-46655 ATGAGCCACCATGCCCAGGCTGG - Intergenic
1203657337 Un_KI270753v1:10890-10912 CCGAGCCACCATGCCCAGGCAGG - Intergenic
1185754346 X:2641519-2641541 CTGAGCCACCATGCCCAGCCAGG + Intergenic
1188884508 X:35532667-35532689 CTTAGCCAACCTAGCAAGGCAGG + Intergenic
1189187286 X:39065328-39065350 CTGAGCCCACCTGGCCAGGCAGG - Intergenic
1189404921 X:40712819-40712841 ATGAGCCATCATCCCCAGCCGGG + Intronic
1197787983 X:130219288-130219310 TTTCGCCAACATGGCCAGGCTGG - Intronic
1199764008 X:150927477-150927499 GTGAGCCACCATCCCCAGCCCGG + Intergenic
1202601577 Y:26598593-26598615 CTGAGCCACCATGCCCAGCCTGG - Intergenic