ID: 1133324262

View in Genome Browser
Species Human (GRCh38)
Location 16:4933976-4933998
Sequence CTGAGCCAACATCGCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133324258_1133324262 -1 Left 1133324258 16:4933954-4933976 CCCTGCATTATTTCATTTAATCC 0: 4
1: 9
2: 104
3: 337
4: 1082
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324257_1133324262 0 Left 1133324257 16:4933953-4933975 CCCCTGCATTATTTCATTTAATC 0: 1
1: 1
2: 10
3: 115
4: 690
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324256_1133324262 5 Left 1133324256 16:4933948-4933970 CCTTTCCCCTGCATTATTTCATT 0: 1
1: 0
2: 5
3: 73
4: 633
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324259_1133324262 -2 Left 1133324259 16:4933955-4933977 CCTGCATTATTTCATTTAATCCT 0: 3
1: 20
2: 108
3: 369
4: 1164
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324254_1133324262 29 Left 1133324254 16:4933924-4933946 CCTGCGGCCGCTTATCATTCACA 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189
1133324255_1133324262 22 Left 1133324255 16:4933931-4933953 CCGCTTATCATTCACAACCTTTC 0: 1
1: 0
2: 2
3: 11
4: 227
Right 1133324262 16:4933976-4933998 CTGAGCCAACATCGCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133324262 Original CRISPR CTGAGCCAACATCGCCAGGC AGG Intronic