ID: 1133325088

View in Genome Browser
Species Human (GRCh38)
Location 16:4937260-4937282
Sequence TCCAAGCCCCGCCCGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133325088_1133325099 4 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325099 16:4937287-4937309 GGGGTGGGGACACTGGGTCTTGG 0: 1
1: 0
2: 2
3: 71
4: 469
1133325088_1133325097 -3 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325097 16:4937280-4937302 GGACGCGGGGGTGGGGACACTGG 0: 1
1: 0
2: 11
3: 54
4: 462
1133325088_1133325102 29 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325102 16:4937312-4937334 GGACGCCGCCCACCCCCAGCCGG 0: 1
1: 0
2: 0
3: 21
4: 181
1133325088_1133325096 -10 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325096 16:4937273-4937295 GGGGCTTGGACGCGGGGGTGGGG 0: 1
1: 0
2: 3
3: 42
4: 539
1133325088_1133325103 30 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325103 16:4937313-4937335 GACGCCGCCCACCCCCAGCCGGG 0: 1
1: 0
2: 2
3: 38
4: 388
1133325088_1133325098 -2 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325098 16:4937281-4937303 GACGCGGGGGTGGGGACACTGGG 0: 1
1: 1
2: 0
3: 28
4: 211
1133325088_1133325100 8 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325100 16:4937291-4937313 TGGGGACACTGGGTCTTGGCCGG 0: 1
1: 1
2: 1
3: 28
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133325088 Original CRISPR TCCAAGCCCCGCCCGCGCGG TGG (reversed) Intronic