ID: 1133325096

View in Genome Browser
Species Human (GRCh38)
Location 16:4937273-4937295
Sequence GGGGCTTGGACGCGGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 539}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133325072_1133325096 26 Left 1133325072 16:4937224-4937246 CCCCGAGAAGGTGGTGCTTACCT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1133325096 16:4937273-4937295 GGGGCTTGGACGCGGGGGTGGGG 0: 1
1: 0
2: 3
3: 42
4: 539
1133325088_1133325096 -10 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325096 16:4937273-4937295 GGGGCTTGGACGCGGGGGTGGGG 0: 1
1: 0
2: 3
3: 42
4: 539
1133325074_1133325096 24 Left 1133325074 16:4937226-4937248 CCGAGAAGGTGGTGCTTACCTTC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1133325096 16:4937273-4937295 GGGGCTTGGACGCGGGGGTGGGG 0: 1
1: 0
2: 3
3: 42
4: 539
1133325082_1133325096 1 Left 1133325082 16:4937249-4937271 CCGAGGAGGGGCCACCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1133325096 16:4937273-4937295 GGGGCTTGGACGCGGGGGTGGGG 0: 1
1: 0
2: 3
3: 42
4: 539
1133325079_1133325096 6 Left 1133325079 16:4937244-4937266 CCTTCCCGAGGAGGGGCCACCGC 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1133325096 16:4937273-4937295 GGGGCTTGGACGCGGGGGTGGGG 0: 1
1: 0
2: 3
3: 42
4: 539
1133325073_1133325096 25 Left 1133325073 16:4937225-4937247 CCCGAGAAGGTGGTGCTTACCTT 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1133325096 16:4937273-4937295 GGGGCTTGGACGCGGGGGTGGGG 0: 1
1: 0
2: 3
3: 42
4: 539
1133325080_1133325096 2 Left 1133325080 16:4937248-4937270 CCCGAGGAGGGGCCACCGCGCGG 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1133325096 16:4937273-4937295 GGGGCTTGGACGCGGGGGTGGGG 0: 1
1: 0
2: 3
3: 42
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133325096 Original CRISPR GGGGCTTGGACGCGGGGGTG GGG Intronic