ID: 1133325099

View in Genome Browser
Species Human (GRCh38)
Location 16:4937287-4937309
Sequence GGGGTGGGGACACTGGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 2, 3: 71, 4: 469}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133325089_1133325099 1 Left 1133325089 16:4937263-4937285 CCGCGCGGGCGGGGCTTGGACGC 0: 1
1: 0
2: 1
3: 10
4: 84
Right 1133325099 16:4937287-4937309 GGGGTGGGGACACTGGGTCTTGG 0: 1
1: 0
2: 2
3: 71
4: 469
1133325080_1133325099 16 Left 1133325080 16:4937248-4937270 CCCGAGGAGGGGCCACCGCGCGG 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1133325099 16:4937287-4937309 GGGGTGGGGACACTGGGTCTTGG 0: 1
1: 0
2: 2
3: 71
4: 469
1133325079_1133325099 20 Left 1133325079 16:4937244-4937266 CCTTCCCGAGGAGGGGCCACCGC 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1133325099 16:4937287-4937309 GGGGTGGGGACACTGGGTCTTGG 0: 1
1: 0
2: 2
3: 71
4: 469
1133325088_1133325099 4 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325099 16:4937287-4937309 GGGGTGGGGACACTGGGTCTTGG 0: 1
1: 0
2: 2
3: 71
4: 469
1133325082_1133325099 15 Left 1133325082 16:4937249-4937271 CCGAGGAGGGGCCACCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1133325099 16:4937287-4937309 GGGGTGGGGACACTGGGTCTTGG 0: 1
1: 0
2: 2
3: 71
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133325099 Original CRISPR GGGGTGGGGACACTGGGTCT TGG Intronic