ID: 1133325102

View in Genome Browser
Species Human (GRCh38)
Location 16:4937312-4937334
Sequence GGACGCCGCCCACCCCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133325088_1133325102 29 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325102 16:4937312-4937334 GGACGCCGCCCACCCCCAGCCGG 0: 1
1: 0
2: 0
3: 21
4: 181
1133325089_1133325102 26 Left 1133325089 16:4937263-4937285 CCGCGCGGGCGGGGCTTGGACGC 0: 1
1: 0
2: 1
3: 10
4: 84
Right 1133325102 16:4937312-4937334 GGACGCCGCCCACCCCCAGCCGG 0: 1
1: 0
2: 0
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133325102 Original CRISPR GGACGCCGCCCACCCCCAGC CGG Intronic