ID: 1133325103

View in Genome Browser
Species Human (GRCh38)
Location 16:4937313-4937335
Sequence GACGCCGCCCACCCCCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133325088_1133325103 30 Left 1133325088 16:4937260-4937282 CCACCGCGCGGGCGGGGCTTGGA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1133325103 16:4937313-4937335 GACGCCGCCCACCCCCAGCCGGG 0: 1
1: 0
2: 2
3: 38
4: 388
1133325089_1133325103 27 Left 1133325089 16:4937263-4937285 CCGCGCGGGCGGGGCTTGGACGC 0: 1
1: 0
2: 1
3: 10
4: 84
Right 1133325103 16:4937313-4937335 GACGCCGCCCACCCCCAGCCGGG 0: 1
1: 0
2: 2
3: 38
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133325103 Original CRISPR GACGCCGCCCACCCCCAGCC GGG Intronic