ID: 1133325548

View in Genome Browser
Species Human (GRCh38)
Location 16:4940144-4940166
Sequence GTCTCACTCTACCACCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9639
Summary {0: 1, 1: 1, 2: 131, 3: 2622, 4: 6884}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133325541_1133325548 13 Left 1133325541 16:4940108-4940130 CCACGCCCGGCCTTTAATTTATT 0: 1
1: 16
2: 168
3: 1331
4: 5971
Right 1133325548 16:4940144-4940166 GTCTCACTCTACCACCGGGCTGG 0: 1
1: 1
2: 131
3: 2622
4: 6884
1133325542_1133325548 8 Left 1133325542 16:4940113-4940135 CCCGGCCTTTAATTTATTTTTTT 0: 1
1: 18
2: 184
3: 3399
4: 13055
Right 1133325548 16:4940144-4940166 GTCTCACTCTACCACCGGGCTGG 0: 1
1: 1
2: 131
3: 2622
4: 6884
1133325540_1133325548 16 Left 1133325540 16:4940105-4940127 CCACCACGCCCGGCCTTTAATTT 0: 2
1: 40
2: 589
3: 4145
4: 17242
Right 1133325548 16:4940144-4940166 GTCTCACTCTACCACCGGGCTGG 0: 1
1: 1
2: 131
3: 2622
4: 6884
1133325543_1133325548 7 Left 1133325543 16:4940114-4940136 CCGGCCTTTAATTTATTTTTTTT 0: 1
1: 9
2: 132
3: 3221
4: 16866
Right 1133325548 16:4940144-4940166 GTCTCACTCTACCACCGGGCTGG 0: 1
1: 1
2: 131
3: 2622
4: 6884
1133325544_1133325548 3 Left 1133325544 16:4940118-4940140 CCTTTAATTTATTTTTTTTAGAA 0: 1
1: 1
2: 30
3: 390
4: 3552
Right 1133325548 16:4940144-4940166 GTCTCACTCTACCACCGGGCTGG 0: 1
1: 1
2: 131
3: 2622
4: 6884

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133325548 Original CRISPR GTCTCACTCTACCACCGGGC TGG Intronic
Too many off-targets to display for this crispr