ID: 1133329142

View in Genome Browser
Species Human (GRCh38)
Location 16:4960571-4960593
Sequence TGTTACAGGCAGATGGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133329138_1133329142 -8 Left 1133329138 16:4960556-4960578 CCACATACCTTGTGCTGTTACAG 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG 0: 1
1: 0
2: 0
3: 17
4: 147
1133329137_1133329142 2 Left 1133329137 16:4960546-4960568 CCAAAATCATCCACATACCTTGT 0: 1
1: 0
2: 1
3: 17
4: 200
Right 1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG 0: 1
1: 0
2: 0
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133329142 Original CRISPR TGTTACAGGCAGATGGTTCT AGG Intronic
900944209 1:5820618-5820640 TGCAAGAGGCAGATGGGTCTTGG + Intergenic
901747128 1:11381359-11381381 TGTTGCAGGCTGCTGCTTCTTGG - Intergenic
904925427 1:34043828-34043850 TGTGACAGGAAGAGGGGTCTAGG + Intronic
907499092 1:54865489-54865511 TGTTACACCCCGATGGTGCTGGG - Intronic
910559389 1:88574324-88574346 TGTTCCTAGCAGATGGTTTTGGG - Intergenic
913217784 1:116634985-116635007 GGTTACAGTCAGATGGTGGTTGG - Intronic
914249007 1:145906742-145906764 TGTTAGAGACAGATGGTGATGGG - Exonic
916227949 1:162508562-162508584 GATTACAGGCAGATGCTGCTAGG - Intronic
916459354 1:165007266-165007288 TGTTACAGTCGGATGTATCTGGG - Intergenic
916476758 1:165176985-165177007 TGTTACATGCCCATGGTCCTAGG - Intergenic
917422274 1:174877031-174877053 TATTACATGAAGATTGTTCTTGG - Intronic
917527115 1:175797940-175797962 TTTTTCAGACAGATGGTTATTGG - Intergenic
918656329 1:187030365-187030387 TGTTAGAGGCAGAATTTTCTTGG - Intergenic
918862536 1:189850216-189850238 TGGTATACGAAGATGGTTCTAGG - Intergenic
922594722 1:226804821-226804843 TTTTAATGACAGATGGTTCTGGG - Intergenic
922945510 1:229510532-229510554 TGTTTCAGGCAGAGGATCCTTGG + Intergenic
924037436 1:239951656-239951678 TGTGAAAGGCAGAAGGTCCTTGG + Intergenic
1063062158 10:2567212-2567234 TGTTGCAGGCAGGTGCTTTTTGG - Intergenic
1063270701 10:4507577-4507599 TGTTACAGGCATCTGGTTGGGGG + Intergenic
1067067347 10:43111430-43111452 TGTTACAAGCAGCTGGGCCTGGG - Exonic
1069204261 10:65661936-65661958 TGTTGCAGGCAGCTGATGCTGGG - Intergenic
1069906018 10:71732657-71732679 TGTTACAGGGATATTGATCTCGG - Intronic
1070680516 10:78445780-78445802 TGTGGCAGGAGGATGGTTCTTGG + Intergenic
1070796819 10:79221680-79221702 TGAGACAGGCAGAAGGCTCTTGG - Intronic
1075040138 10:119101618-119101640 TGTCACAGACAGATGGAGCTGGG - Intergenic
1075390434 10:122087300-122087322 TGTCGCAGGCAGATGTTTCCTGG - Exonic
1078923396 11:15852190-15852212 CGTTAGAGTCAGATGGATCTGGG - Intergenic
1085100852 11:73798545-73798567 AGTTACAGGGAGATGGGTTTGGG + Intronic
1088688375 11:112304252-112304274 TGTTACAGGCATATGGGGCAGGG + Intergenic
1089405566 11:118194630-118194652 TGTTGCAGCCAGATGGTCTTGGG - Intronic
1089742917 11:120597311-120597333 TGTTTCCCGCAGAGGGTTCTGGG + Intronic
1090250431 11:125247153-125247175 CGGGAAAGGCAGATGGTTCTGGG - Intronic
1095989305 12:48023378-48023400 TGTTACAGGCAGTTCCTTCAGGG - Intronic
1097018511 12:56004036-56004058 AGGTACAGGCAGATGGTTCCGGG - Exonic
1097401084 12:59128970-59128992 TGTAAAAGGAAGATGTTTCTAGG + Intergenic
1097657552 12:62386784-62386806 TGTTTCAGAAAGATGATTCTGGG + Intronic
1103238434 12:119394361-119394383 TGTAACAGGCAGAAGGAACTAGG - Intronic
1109616718 13:64843672-64843694 TGGTACAGGAAGATGATGCTGGG + Intergenic
1109683312 13:65782260-65782282 TTTTCCAGGCAGAGTGTTCTGGG + Intergenic
1112146527 13:96706203-96706225 TGTTAGGGGCATATGGTCCTAGG - Intronic
1112464107 13:99628777-99628799 TTTTATAGACAGATGTTTCTTGG - Intronic
1112560478 13:100508420-100508442 TGTTACTGGTAGGTGGTTCTTGG - Intronic
1113912283 13:113848563-113848585 AGTGACAGGCAGGTGGTTCCAGG - Intronic
1114051124 14:18920493-18920515 TGTGGCAGGCAGCTGGTTCGGGG + Intergenic
1114111435 14:19481429-19481451 TGTGGCAGGCAGCTGGTTCGGGG - Intergenic
1114262554 14:21048562-21048584 TGTTACCAACAGATGGTTTTTGG + Intronic
1118806806 14:69245046-69245068 TGGGACAGGCAGAAGGTGCTGGG - Intergenic
1120258377 14:82149782-82149804 TGTTGCATTCAGATGGATCTAGG + Intergenic
1121505916 14:94476466-94476488 TGTTGCTGGGAGATGGTTCTTGG - Intronic
1122129433 14:99596584-99596606 CCTCACAGGCAGAGGGTTCTGGG - Intronic
1122903051 14:104789808-104789830 TCTAACAGGGAGATGGTTCCTGG - Intronic
1202903845 14_GL000194v1_random:57550-57572 TGTTGCAGGCAGAGGGTTTGCGG + Intergenic
1124841195 15:33243680-33243702 TGTGCCAGGCACATAGTTCTAGG + Intergenic
1125634171 15:41173288-41173310 TATTAAAAGCGGATGGTTCTAGG + Intergenic
1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG + Intronic
1134369909 16:13613614-13613636 TGTTACAGAGAGCTGGTTATGGG - Intergenic
1135293040 16:21256576-21256598 TGTTACAGGAACATGGTTCAGGG - Intronic
1137255250 16:46769679-46769701 TTTTTCAGGCTGCTGGTTCTGGG - Intronic
1138431106 16:56969751-56969773 TTGTGCAGGCAGAGGGTTCTGGG + Intronic
1140896294 16:79327428-79327450 TCTTGGAGGCAGATGGGTCTGGG + Intergenic
1141098391 16:81179213-81179235 TGTTACAAGCAGGTCATTCTGGG - Intergenic
1146475486 17:33159307-33159329 TGTTACAGGCAGACGATTTTGGG - Intronic
1150417779 17:65001427-65001449 GGTTGTAGGGAGATGGTTCTAGG - Intergenic
1151367948 17:73629294-73629316 TGGGACAGGCAGATGCGTCTGGG - Intronic
1152030072 17:77836822-77836844 TGTTTTTGGCAGGTGGTTCTTGG - Intergenic
1152476973 17:80524860-80524882 TGTTAGGGGCAGATGATTCTTGG - Intergenic
1155949709 18:31897992-31898014 AGTTGCAGGGAGATGGTTCCAGG + Intronic
1157175700 18:45450001-45450023 TGAGACAGGCAGATGGTTCATGG - Intronic
1159865243 18:73696190-73696212 CGTTACTGGCATATGGATCTTGG - Intergenic
1160613628 18:80108277-80108299 TGTTCCAGGCAGTTCCTTCTTGG - Intergenic
1162390983 19:10390133-10390155 GGCAACAGGCAGATGGTGCTGGG + Intergenic
1163697891 19:18773185-18773207 TCTCAGGGGCAGATGGTTCTAGG + Intronic
1165118849 19:33546163-33546185 GGTGACAGACAGATGGTCCTGGG - Intergenic
1168241227 19:55089851-55089873 TGGTGCAGGCAGATGGTTGAAGG - Intergenic
929420110 2:41781682-41781704 ATTTACAGGCAAATAGTTCTTGG - Intergenic
930742325 2:54844203-54844225 TGTCACAGCCAGAGGCTTCTTGG - Exonic
931278041 2:60761733-60761755 TTTTATAGGCTGGTGGTTCTTGG + Exonic
932719298 2:74126324-74126346 TGTTTCAGGCAGAGGTTTTTTGG + Intergenic
936002708 2:108850059-108850081 TGTCAGAGCCAGATGGTCCTCGG + Intronic
937204679 2:120227826-120227848 TGTTACAGGGAGGTGCTGCTGGG + Intergenic
938208149 2:129441126-129441148 TGTGACGTGCAGATGGTTCCAGG + Intergenic
948508846 2:238449428-238449450 GGTGACAGTCAGATGCTTCTGGG - Exonic
1171112769 20:22499745-22499767 TTCTACAGGCAGATGGTGCTGGG + Intergenic
1172381198 20:34493903-34493925 CCCTACATGCAGATGGTTCTAGG - Intronic
1174170077 20:48611872-48611894 ATGTAGAGGCAGATGGTTCTTGG - Intergenic
1175371690 20:58496754-58496776 TGTTACAGGCAGAAGCTGCAAGG + Intronic
1176623217 21:9072318-9072340 TGTTGCAGGCAGAGGGTTTGCGG + Intergenic
1177317682 21:19481369-19481391 TGGTCTTGGCAGATGGTTCTGGG - Intergenic
1177467462 21:21506119-21506141 TCTCACATGCAGATAGTTCTAGG - Intronic
1178011074 21:28287908-28287930 TGTAACAGGCAGATGCATATAGG - Intergenic
1180469599 22:15642868-15642890 TGTGGCAGGCAGCTGGTTCGGGG + Intergenic
1181167896 22:20993098-20993120 TGGGGCAGGCAGATGGTGCTGGG + Intronic
1181974007 22:26715158-26715180 TGTCACAGGTGGATGGGTCTTGG + Intergenic
1183700378 22:39447815-39447837 AGTTCCAGGCAGCGGGTTCTAGG + Intergenic
1184518276 22:44976661-44976683 TAGTACAGGCAGATGGGTCTGGG - Intronic
950945841 3:16945099-16945121 TGTTCCAGGCAGAGGGAACTGGG - Intronic
952700261 3:36320334-36320356 TGTCACAGTCAGATTGTTCTGGG + Intergenic
955458346 3:59150592-59150614 TAATATAGGCAGAGGGTTCTGGG - Intergenic
955795765 3:62635296-62635318 TATTAGAGGCAGAAGGCTCTGGG - Intronic
959901340 3:111665138-111665160 TGTTAAAGACAGATGAATCTAGG + Intronic
962288051 3:134105164-134105186 TTTTGCAGGCACATTGTTCTTGG - Intronic
963047144 3:141110962-141110984 TGTTACATGCACAGGTTTCTGGG - Intronic
965622520 3:170655551-170655573 TGGTACAGGCTGATGGTACAAGG + Intronic
967703407 3:192620961-192620983 TGTTAGAGTCAGATGATGCTGGG - Intronic
968005769 3:195241685-195241707 GGATTCAGGCAGAAGGTTCTGGG - Intronic
969399174 4:6942565-6942587 TGTTACAGGTACATGTTTATAGG + Intronic
970630869 4:17943025-17943047 TGTTGCAGGGAGATGGTTTCGGG - Intronic
971287412 4:25303817-25303839 TGATACAGGCAGATTGTACTGGG + Intergenic
971785295 4:31094637-31094659 TGTTAGAGGCAAATGGAACTGGG + Intronic
973327548 4:48878632-48878654 TGTGCCATGCAGATGGTTCAGGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976322217 4:83728731-83728753 TTTTACAGGTAGTTGGATCTGGG - Intergenic
977534534 4:98241633-98241655 TGTTATAGGAAGATAATTCTGGG - Intergenic
979720302 4:123891960-123891982 TGCTTGAGGCTGATGGTTCTGGG - Intergenic
980015462 4:127645431-127645453 AGTTACAGGCAGATGGTGGTTGG - Intronic
984413972 4:179433537-179433559 TGTAAAAGCCAGATGGTTTTTGG - Intergenic
985707991 5:1412686-1412708 TGTTGCAGGCAGATTGGGCTTGG - Intronic
986114278 5:4754623-4754645 TGTTACAGGGAGAAGGAACTGGG - Intergenic
986173282 5:5331159-5331181 TGTGACAGGGTGCTGGTTCTGGG - Intergenic
996795372 5:127340856-127340878 TGTTACAGAAAGATGATTCAAGG + Intronic
999122710 5:149221418-149221440 TGGTACTGGCAAATGGTCCTTGG + Intronic
999595274 5:153196655-153196677 TTTATCAGGCAAATGGTTCTGGG - Intergenic
1000148320 5:158474825-158474847 TCTAACAGGAAGATGGATCTTGG - Intergenic
1001757448 5:174181353-174181375 AGTTACAGGCAGATGCTTCAAGG + Intronic
1002278871 5:178119549-178119571 GGGTACAGGCAGCTGCTTCTGGG - Exonic
1004057995 6:12160579-12160601 TGTTACAGGCAGATTTTTAAAGG + Intronic
1004848133 6:19668432-19668454 TCATTGAGGCAGATGGTTCTAGG - Intergenic
1008541300 6:52548657-52548679 TGTCACGGTCAGATGGATCTTGG - Intronic
1012953121 6:105540164-105540186 TCTTAGAGGCAAATAGTTCTGGG + Intergenic
1013926592 6:115480460-115480482 TCTTACAGGCAGGTGCCTCTGGG - Intergenic
1017874985 6:158516921-158516943 TGTTACATGGAGTTGGCTCTGGG - Intergenic
1018298801 6:162377888-162377910 AGTGAAAGCCAGATGGTTCTTGG + Intronic
1026080000 7:67209309-67209331 TGGTACAGTCAGCTGTTTCTGGG + Intronic
1026759896 7:73118854-73118876 TGTTACAGGCAGAATGTTTGTGG + Intergenic
1027036238 7:74927666-74927688 TGTTACAGGCAGAATGTTTGTGG + Intergenic
1027087325 7:75273798-75273820 TGTTACAGGCAGAATGTTTGTGG - Intergenic
1029393631 7:100291768-100291790 TGTTACAGGCAGAATGTTTGTGG - Intergenic
1031970203 7:128059254-128059276 TGGTACAGGCAGCAGGTACTAGG - Intronic
1032384473 7:131511924-131511946 TGTTCCTGGCAGCTGGTTCTGGG - Intronic
1033088432 7:138363533-138363555 TGTTACAGGCACATACTCCTAGG + Intergenic
1034843671 7:154422991-154423013 TATTACCTGCTGATGGTTCTCGG + Intronic
1036954950 8:13178051-13178073 TGTTTCAGTAAAATGGTTCTGGG + Intronic
1039821342 8:41138104-41138126 AGATAAAGGCATATGGTTCTAGG - Intergenic
1046821028 8:118634527-118634549 TGGTACAGGATGAAGGTTCTTGG + Intergenic
1046824980 8:118678762-118678784 TGTTGGAGGCAGATTGCTCTGGG + Intergenic
1050732991 9:8730760-8730782 TCTTACAGCCGAATGGTTCTCGG + Intronic
1053268058 9:36730354-36730376 TGTGCCAGGCACAGGGTTCTGGG + Intergenic
1055531552 9:77189392-77189414 TGTTAAAATCAGATGGTTGTAGG + Intronic
1055979281 9:81986056-81986078 TGTGACAGGCAGTTGGTATTTGG + Intergenic
1058381279 9:104379616-104379638 TGTTACAGGCAGGTGACTGTAGG + Intergenic
1059427823 9:114232038-114232060 GGGCTCAGGCAGATGGTTCTGGG + Intronic
1059522832 9:114959829-114959851 TGTTACAGGCAGATAGATATGGG + Intergenic
1060007552 9:120013977-120013999 TGTTTTAGGCAGATGACTCTGGG + Intergenic
1203746402 Un_GL000218v1:42745-42767 TGTTGCAGGCAGAGGGTTTGCGG + Intergenic
1185964621 X:4586618-4586640 TGAGACAGGCAGATGGTTTGAGG + Intergenic
1188638144 X:32462046-32462068 TGTTAGAGGCAGTTGGTCTTTGG - Intronic
1188749891 X:33892590-33892612 TGTTTCTTGCAGATGGTTCTTGG + Intergenic
1194193250 X:90862439-90862461 GGTTTGAGGCAGATGGTTTTGGG + Intergenic
1194837624 X:98700232-98700254 TGCTACAGGGAGATGGATTTTGG - Intergenic
1195115982 X:101698032-101698054 TGGTACTGGCATATGCTTCTGGG - Intergenic
1196795503 X:119499217-119499239 TGTTAAAAGCAGATGAATCTGGG + Intergenic
1198101039 X:133421983-133422005 TGTTATAGGAAGATGGATTTGGG - Intergenic
1200032982 X:153311316-153311338 TGGTACAGGCACATGGTACTTGG - Intergenic
1200384152 X:155872532-155872554 TGTTTTAGGCCAATGGTTCTAGG + Intergenic
1200539866 Y:4444821-4444843 GGTTTGAGGCAGATGGTTTTGGG + Intergenic