ID: 1133329353

View in Genome Browser
Species Human (GRCh38)
Location 16:4962361-4962383
Sequence CTGTGGGTAGAGTGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133329346_1133329353 18 Left 1133329346 16:4962320-4962342 CCATTTACTCCCTTCGCTGTTGA 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1133329353 16:4962361-4962383 CTGTGGGTAGAGTGAAAAAAAGG 0: 1
1: 0
2: 3
3: 33
4: 327
1133329349_1133329353 8 Left 1133329349 16:4962330-4962352 CCTTCGCTGTTGAGTCTCTAGGT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1133329353 16:4962361-4962383 CTGTGGGTAGAGTGAAAAAAAGG 0: 1
1: 0
2: 3
3: 33
4: 327
1133329347_1133329353 9 Left 1133329347 16:4962329-4962351 CCCTTCGCTGTTGAGTCTCTAGG 0: 1
1: 0
2: 2
3: 4
4: 68
Right 1133329353 16:4962361-4962383 CTGTGGGTAGAGTGAAAAAAAGG 0: 1
1: 0
2: 3
3: 33
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133329353 Original CRISPR CTGTGGGTAGAGTGAAAAAA AGG Intronic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
902862112 1:19253888-19253910 CTGTGGGTAGAGGGCAAATTGGG + Intronic
905888550 1:41505086-41505108 CTGAGTGTTGAGTGAATAAATGG - Intergenic
907271171 1:53292075-53292097 CTGTGGGTAGATTTGAATAAAGG - Intronic
907730681 1:57062477-57062499 CTGAGGATGGAGTGAGAAAATGG + Intronic
907964424 1:59315431-59315453 TGGTGGGGAGAGGGAAAAAAGGG - Intronic
908236055 1:62148261-62148283 CTGGGGAAAAAGTGAAAAAAAGG - Intronic
908481111 1:64540338-64540360 GTGTTGGGAGAGTGAAAATAGGG + Intronic
909761096 1:79288430-79288452 GTGTTGGTAGAGTGTAAAAATGG - Intergenic
909783488 1:79580208-79580230 CTGAGGGTAGAGAGAAATGAGGG - Intergenic
910582960 1:88848383-88848405 GTGTGGGTAGAGGGAAAAAGAGG + Intergenic
911748534 1:101468382-101468404 CTGATGGTAGAAAGAAAAAAAGG + Intergenic
912429210 1:109620329-109620351 CTGTGGCCAGAGTGACAAGAGGG + Intronic
915985238 1:160457940-160457962 CTGGGGATAGAATGGAAAAAGGG + Intergenic
916244482 1:162673700-162673722 CTGTAGGTGAAGGGAAAAAATGG - Intronic
916487185 1:165270341-165270363 ATGTGGGTACACTGAAAACAAGG + Intronic
917186019 1:172356706-172356728 ATGTGGGTGGAGAGAAACAAAGG - Intronic
917231465 1:172842230-172842252 TTGTGGGATGAGGGAAAAAATGG + Intergenic
917635812 1:176934840-176934862 CTGTGGGTAGTGATCAAAAAAGG + Intronic
918061272 1:181063294-181063316 CTGTGGCTTGAATGAAAATATGG - Intergenic
918589945 1:186229938-186229960 CTGTGGACAGAGTGATTAAAAGG - Intergenic
918846551 1:189622291-189622313 ATGTGGGTAGAGACAAAAAGAGG + Intergenic
924088897 1:240482758-240482780 CTGTTGCCAGAATGAAAAAAAGG + Intergenic
924100380 1:240596883-240596905 CTTCGGGCAGAGAGAAAAAAAGG + Intronic
1063220878 10:3966643-3966665 CTGTGGAGACAGTGAAGAAAAGG - Intergenic
1064549043 10:16480070-16480092 CTATGAGTAGAATGAAACAAGGG + Intronic
1065426880 10:25615380-25615402 CAGTGGGTAGAGTGCTAAACAGG - Intergenic
1066653981 10:37682640-37682662 ATGTTGGTGGAGTGAAAAAAAGG - Intergenic
1067472870 10:46549037-46549059 CTGAGGGTGGAGTGAACAAAAGG + Exonic
1067499905 10:46794134-46794156 CTGTGAGGAGATTGAAAGAAGGG + Intergenic
1067916770 10:50408281-50408303 CTGTGACTAGAATGAATAAAAGG - Intronic
1068234051 10:54209292-54209314 CTGTTGGCAGTGTGAAAAGATGG + Intronic
1068443032 10:57084131-57084153 CTATGTGGAGAGAGAAAAAAGGG - Intergenic
1068854465 10:61783323-61783345 CTTTGGATTGACTGAAAAAAGGG + Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1070365547 10:75733355-75733377 CTGTGGTTTGAGTGAGAATAGGG + Intronic
1071711998 10:88059030-88059052 CTGGGGGCAGGGAGAAAAAAGGG + Intergenic
1071795779 10:89003820-89003842 CTTTGAGTAGAGTTGAAAAAAGG + Intronic
1073595996 10:104800726-104800748 ATATGGGTGGAGTGAGAAAAGGG + Intronic
1074006179 10:109426836-109426858 AAGAGAGTAGAGTGAAAAAAGGG + Intergenic
1074136327 10:110630129-110630151 CTGGGGATAGAGTCAAAGAAAGG + Intergenic
1074922657 10:118032821-118032843 GTGTGGGTACACTGAACAAAGGG - Intronic
1075980163 10:126731517-126731539 CTGTGGGTAAAGCGAAGAATGGG + Intergenic
1076581163 10:131512903-131512925 CCATGGATAGAGAGAAAAAAGGG - Intergenic
1077986461 11:7356155-7356177 CTGTAGTTACAGTCAAAAAACGG + Intronic
1078213680 11:9293074-9293096 CTGTAGGGAGAGAGATAAAATGG - Intronic
1078652485 11:13208642-13208664 CTGTGTATTGAGTGAGAAAATGG - Intergenic
1078908814 11:15712098-15712120 CTGTAGGAAGAGAGAAAATACGG + Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079779851 11:24587826-24587848 CTGTGGTGAGAGGGAAAAAAAGG + Intronic
1079991413 11:27250461-27250483 CATTGGGGAGAGGGAAAAAAAGG + Intergenic
1080688862 11:34538678-34538700 CTCTGGGTAGCCTGTAAAAACGG + Intergenic
1080773507 11:35364223-35364245 CTGTGGGGAGAGTTAAGCAATGG + Intronic
1081383695 11:42446155-42446177 CTGGGGGTGGAGTGAAGAGATGG - Intergenic
1081512133 11:43786157-43786179 AAGTGGGTTGCGTGAAAAAAGGG + Intronic
1081657650 11:44868086-44868108 CTGTGGGGAGATGGAGAAAAAGG + Intronic
1081795690 11:45817843-45817865 CCATGGGAAGAGTGAAGAAAGGG + Intergenic
1083460908 11:62811159-62811181 GACTGGGTAAAGTGAAAAAAAGG - Intronic
1084591498 11:70093232-70093254 GAGGGGGTAGAGTGAAAAAGAGG - Intronic
1085112348 11:73899048-73899070 GTCTTGGAAGAGTGAAAAAAGGG + Intronic
1086185414 11:84008759-84008781 CTTTGGGTAGAGGTAAAACAAGG + Intronic
1087266148 11:96063379-96063401 CTGTGGGTACAGTGCTAAAAAGG - Intronic
1088993626 11:114976797-114976819 CTTTGGGTAGAAAGAAAAGAAGG + Intergenic
1089164395 11:116463864-116463886 CTGTGGTTGGACTGAAAGAAAGG - Intergenic
1089652482 11:119923353-119923375 CTGTGTGTAGAGAGAAAAATAGG - Intergenic
1090229078 11:125088855-125088877 CTGTGGGGAGAGTAGAAAGAGGG + Exonic
1091057181 11:132430129-132430151 CTGTGGCTGGAGGGAAGAAAAGG + Intronic
1093877037 12:24361040-24361062 CTGTGGTTACAGTGAAAGCAAGG + Intergenic
1093928313 12:24930443-24930465 CTGTGGTTAGAGTCAAGAGAGGG - Intronic
1095445781 12:42280786-42280808 CTGGGGGTAAAGTGGAAAATGGG - Intronic
1095731922 12:45515270-45515292 CTATGGGGAGAGAGAAAGAAGGG - Intergenic
1099311025 12:81023095-81023117 CTTTGGGTGAAGTGAAAGAAAGG + Intronic
1099588363 12:84551176-84551198 TTGTGTGTGGAGAGAAAAAATGG - Intergenic
1100741099 12:97594519-97594541 CTGTTGGTAGAGGGATGAAAAGG + Intergenic
1103120405 12:118375555-118375577 TTGTGTGTAGCGAGAAAAAAGGG - Intergenic
1104700196 12:130897159-130897181 CTGTAGGTACTGTGAAAAGAGGG + Intergenic
1106029317 13:25985604-25985626 CTGGGGGCAAAGTGAAAAGATGG - Intronic
1106825185 13:33512767-33512789 CTATGGTTAGAGTGAAAAAACGG - Intergenic
1107419195 13:40230775-40230797 CTGTGGGGAGATAGTAAAAATGG - Intergenic
1109801879 13:67390596-67390618 CAGTGGGTAGAGTGTACACATGG + Intergenic
1110813616 13:79838177-79838199 CTGTGGCTTGAATGATAAAAAGG + Intergenic
1110887625 13:80658443-80658465 CTGTGGGTGGGGTCAAATAAGGG - Intergenic
1110955743 13:81550175-81550197 CTGTGGGTACACTGAAGACAAGG - Intergenic
1111079704 13:83287411-83287433 CTGATGCTAGAGTGAGAAAAAGG - Intergenic
1111123604 13:83883664-83883686 CTCTGCATAGAGTGAAGAAAGGG - Intergenic
1112328637 13:98460441-98460463 CTTGGGGGAGAGGGAAAAAAAGG + Intronic
1113990222 14:16022893-16022915 GTGTGGGTATTGTGAGAAAAAGG + Intergenic
1114649134 14:24272056-24272078 CAGTGGGTGAAGTGAAAAAGGGG - Intergenic
1115595029 14:34901140-34901162 CTGTGGGGAGAGAGAAAGAAAGG + Intergenic
1115851011 14:37590560-37590582 CTGTGGGTAGAGAGGACAAAGGG + Exonic
1115977029 14:39008138-39008160 GTGTGGTTAGAGTGAGAAAAAGG - Intergenic
1116401979 14:44518469-44518491 CTTTGGCTAGACTTAAAAAAAGG - Intergenic
1116434923 14:44886249-44886271 CTGTTGGTAGAGCTGAAAAAAGG + Intergenic
1116445279 14:45002119-45002141 CTTTGGGGTGAGTGCAAAAAAGG - Intronic
1116735030 14:48678306-48678328 CTGTGTGTATAGTAAAGAAAGGG + Intergenic
1117521080 14:56552017-56552039 CTTGGGTTAGAGGGAAAAAAAGG + Intronic
1117720621 14:58625481-58625503 CTGTGTGTAGGGTGAAGAAAAGG - Intergenic
1119267487 14:73271956-73271978 CTCTGGGGAAAGTGAAAAACTGG + Intronic
1119872883 14:78032021-78032043 CAGTGGGTAGAGAGAAAGAAAGG + Intergenic
1120594908 14:86421237-86421259 CTGTGGGTAGAGTAGCAAATGGG + Intergenic
1121245972 14:92460988-92461010 GTGTGGGTAGGGGGAAAAAGAGG + Intronic
1121883149 14:97518175-97518197 CTGTGGGGTCAGTGAAAACAAGG + Intergenic
1123469407 15:20538977-20538999 CTGTGGGGAGAGTCAAAGGAAGG + Intronic
1123648654 15:22461722-22461744 CTGTGGGGAGAGTCAAAGGAAGG - Intronic
1123682660 15:22773726-22773748 CTGTGGGGAGAGTCAAAGGAAGG + Intronic
1123712589 15:22999867-22999889 CTGTGGGAAGAATAAAAATAAGG + Intronic
1123729685 15:23133963-23133985 CTGTGGGGAGAGTCAAAGGAAGG + Intronic
1123747852 15:23331445-23331467 CTGTGGGGAGAGTCAAAGGAAGG + Intergenic
1123762630 15:23444501-23444523 CTGTGGGGAGAGTCAAAGGAAGG + Intronic
1124159335 15:27254609-27254631 GTGAGGTTAGAGTGAGAAAACGG - Intronic
1124280220 15:28355297-28355319 CTGTGGGGAGAGTCAAAGGAAGG + Intergenic
1124302479 15:28556315-28556337 CTGTGGGGAGAGTCAAAGGAAGG - Intergenic
1124334410 15:28846250-28846272 CTGTGGGGAGAGTCAAAGGAAGG + Intergenic
1124563482 15:30795458-30795480 CTGTGGGAAGAGTCAAATTAAGG - Intergenic
1125245479 15:37632132-37632154 CTTTGGATAGAGTCAGAAAATGG - Intergenic
1126266459 15:46760013-46760035 CAGTGGGAAAAGTGAACAAAAGG + Intergenic
1126466456 15:48965257-48965279 ATGTGGGCAGTATGAAAAAATGG + Intergenic
1128014952 15:64335934-64335956 CTGGGGGTATAGTGACAAACAGG - Intronic
1130742566 15:86616452-86616474 CAGTGGGCAGGGTGATAAAATGG + Intronic
1131273207 15:90959408-90959430 CTGTGGGTGCAGTTGAAAAAGGG + Intronic
1132433392 15:101778242-101778264 CTGTGGGGAGAGTCAAATTAAGG + Intergenic
1132482817 16:175083-175105 CTGTGGGCAGAGTCAGAAGAGGG + Intergenic
1133329353 16:4962361-4962383 CTGTGGGTAGAGTGAAAAAAAGG + Intronic
1134343926 16:13371844-13371866 ATTTGGGTAGAGTGAAAAGTAGG - Intergenic
1134906683 16:17985881-17985903 CTCAGGGCAGACTGAAAAAATGG + Intergenic
1135417409 16:22279109-22279131 CTCTGTGTAGACTGTAAAAATGG + Intronic
1136127052 16:28191626-28191648 CTGTGGGTCAAGTGAAGACAGGG + Intronic
1137420191 16:48326812-48326834 CTGTGGGAAGAGGGAGGAAAGGG - Intronic
1138532694 16:57643447-57643469 CTGTGGGAAGAGTGACAAAGGGG - Intronic
1139602953 16:67997923-67997945 CAGTGGGCAGAGTGGAAACAAGG - Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140987327 16:80170699-80170721 CTGAGGGTAGAGGGAAGTAAGGG + Intergenic
1144075902 17:11719196-11719218 CTGTGGGGAGCGGGAAAAAGGGG + Intronic
1147394460 17:40130954-40130976 TTGTGGGCATAGTGAAACAAAGG + Intronic
1148447647 17:47747877-47747899 CTCTGAGTAGAGAGCAAAAAAGG - Intergenic
1148604219 17:48916644-48916666 TTGTTGGTATAGGGAAAAAAAGG + Intronic
1149020068 17:51952807-51952829 CTTTGGGAAGAATGAAATAAAGG - Intronic
1151002186 17:70390312-70390334 GTGGGGGTAGAGGGAAAAAAAGG + Intergenic
1151315661 17:73320596-73320618 TTGTGGGGAGAGTGAGGAAAAGG + Intergenic
1154277977 18:12978657-12978679 TTGTGAGCAGTGTGAAAAAAAGG + Intronic
1155459808 18:26065846-26065868 GTGTATGTAGACTGAAAAAAAGG - Intronic
1155737435 18:29241086-29241108 CTGTGGGTAGTGTGAAAAATAGG + Intergenic
1156047432 18:32892793-32892815 GAGTGGGTAGAGTTAGAAAAGGG + Intergenic
1156247351 18:35314475-35314497 CTTTGGGTAGACTGAACATAGGG - Intergenic
1156854947 18:41770969-41770991 GCTTGGGCAGAGTGAAAAAATGG + Intergenic
1157240850 18:46008272-46008294 GTGTGAGTAGAGAGAAAAACGGG - Intronic
1162512725 19:11129434-11129456 CCGTGGCTGGAGTGAAAACACGG - Intronic
1165043048 19:33082407-33082429 ATGTGGTCAGGGTGAAAAAAGGG - Intronic
1167077493 19:47258307-47258329 CTGGGGACAGAGGGAAAAAAAGG - Intronic
1167497989 19:49830488-49830510 CTGTGGGTAGAAGGGAAGAAGGG - Intronic
1168569183 19:57450770-57450792 CTGTGGGTTGAGAGCAAAATTGG + Intronic
925501793 2:4513072-4513094 ATGTGGGTAGTGAGGAAAAACGG + Intergenic
925702695 2:6654902-6654924 TTGTTGGTTGAGTGAAGAAATGG - Intergenic
926490923 2:13525713-13525735 ATTGTGGTAGAGTGAAAAAACGG + Intergenic
927144156 2:20150370-20150392 GTGTGGGTCGAATGAATAAATGG + Intergenic
927296413 2:21459657-21459679 CTGTGGATGGAGTGTAAGAATGG - Intergenic
929108197 2:38384365-38384387 CTGTGGGGAAAATGAAAAGATGG - Intergenic
930076944 2:47413830-47413852 GTGAGGTTAGAGTGAGAAAATGG - Intronic
931106364 2:59060997-59061019 CTGTGTGTATAGTGAAAGGAGGG - Intergenic
933177387 2:79190915-79190937 CTATGGGTAGAGTGAGAAGATGG - Intronic
933277440 2:80299171-80299193 CTGTGGGAAGAATAAAAAAAAGG + Intronic
934078088 2:88444714-88444736 CTGTGGGGAGAGTGAACGACTGG - Intergenic
934890789 2:98067241-98067263 CGGTGGGTAGAGAGAATAGAGGG - Intergenic
939749238 2:146020603-146020625 CTGTGGGTAGTATGAAAATCTGG - Intergenic
940480146 2:154218519-154218541 CAGTGGGTAGAGTAATAAATTGG - Intronic
941777786 2:169411531-169411553 CTTTGGGTATAGTCAAAAAAGGG - Intergenic
943896645 2:193370924-193370946 CTGTGTGTTGAATGAAAAAAAGG - Intergenic
944297525 2:198083913-198083935 CTGTGTCCAGAGTGAAAAAACGG - Exonic
945065830 2:205946888-205946910 ATGTGGGTAGAGAGAAAAAGAGG + Intergenic
945420737 2:209633085-209633107 CTGAGGTTAGAATGAAGAAAAGG - Intronic
946802127 2:223429656-223429678 GAGTGGGTAGAGTGAAAATCAGG - Intergenic
947112940 2:226739019-226739041 CTGTGAGGAGAGGGAAAAACAGG + Intronic
1169060417 20:2656697-2656719 CTGAGGGTAGAGGGAACACAGGG + Intronic
1169514252 20:6298933-6298955 ATGTGGGTAGTGAGAAATAAAGG + Intergenic
1169554083 20:6731321-6731343 CTGTGTGTAAAGTGGAGAAAAGG - Intergenic
1171385785 20:24768639-24768661 CTTTGGGAAGAGAGAAAGAAGGG - Intergenic
1172527240 20:35607317-35607339 GTGTGGGTAGAGAAAAGAAATGG + Intergenic
1173041206 20:39464728-39464750 CTGTGGGTAGAGGGGAAAAAAGG - Intergenic
1173906516 20:46633673-46633695 CAGTGGGTAGAGTTTAACAAGGG - Intronic
1173940822 20:46909701-46909723 CTGTGGATGGAGTGAGAGAAAGG + Intronic
1175039198 20:56029863-56029885 CTGTGGATACAGAGAAAAGATGG + Intergenic
1176786034 21:13257670-13257692 ATAGGGGTAGAGAGAAAAAAAGG + Intergenic
1179110201 21:38439538-38439560 GTGAGGCTAGAGTGAAGAAAGGG + Intronic
1179221661 21:39413223-39413245 CTCTTGGTGGAGTGAAAAAGAGG - Intronic
1180317049 22:11284633-11284655 GTGTGGGTATTGTGAGAAAAAGG - Intergenic
1182131605 22:27857032-27857054 CTGTGGCTAGACTAAAAATAAGG + Intronic
1182505583 22:30779909-30779931 CTGTGGGGAGAGAGACACAAAGG - Intronic
1184178274 22:42802105-42802127 CTGTGGGAAGAGTGAGGAGAGGG + Intronic
1185352986 22:50347691-50347713 CAGTGGGTACAGTGACAAAGAGG - Intronic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
949790586 3:7787690-7787712 CTCTGGGTATAATGAGAAAATGG - Intergenic
950017856 3:9766980-9767002 CTGGGGGGAGAGTGGAAAAAGGG - Intronic
950658997 3:14455047-14455069 CTGTCTGTAGAGTGAAAGATTGG - Intronic
951706379 3:25547793-25547815 CGGTGGGTGGATGGAAAAAAGGG + Intronic
951720007 3:25688304-25688326 CTGTGGATGGAGTGAAAACTGGG - Intergenic
952625716 3:35400561-35400583 ATTTGTGTAGAGTAAAAAAATGG - Intergenic
953879099 3:46682353-46682375 CTGTTGGTCAAGGGAAAAAAGGG - Intronic
954527242 3:51283084-51283106 CTGTGGGTAGAGGGAAAGTCAGG - Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
955595913 3:60590377-60590399 CTGGGGGTGGAGTGTAAAAGTGG - Intronic
955786123 3:62540836-62540858 CTGTTTGTACAGGGAAAAAATGG - Intronic
955801011 3:62686503-62686525 CTGTGGCTAGAGGGGAGAAATGG + Intronic
956081695 3:65564108-65564130 CTTTGAGAAGAGTGAAACAATGG - Intronic
956830049 3:73038007-73038029 GAGTTGGTAGAATGAAAAAAAGG + Intronic
956944767 3:74207890-74207912 CTGTCTGTAGTGTGAAAAATTGG + Intergenic
957366651 3:79233278-79233300 CTTTGGGTGAAGTGAAAAAATGG + Intronic
957420065 3:79955892-79955914 CCCTCGGTAGAGTAAAAAAAAGG - Intergenic
957620460 3:82586116-82586138 CTGTGGGGAAAATGAAAAGATGG - Intergenic
957936159 3:86945409-86945431 ATGTGGGTGGAGAGAAAAATGGG + Exonic
958018084 3:87966153-87966175 CTGAGGTTAGAGTGAGAAGACGG - Intergenic
958812602 3:98879039-98879061 CTGTTGGTAGAGTGGAAGAGTGG - Intronic
959171070 3:102844359-102844381 CTGTGAGTATACTGAAAATATGG - Intergenic
959552460 3:107678239-107678261 CTGTGGGTAGAGAAAAAATGGGG - Intronic
964060218 3:152512968-152512990 GTCATGGTAGAGTGAAAAAAAGG + Intergenic
964645631 3:158956162-158956184 CTGAGGGCAGAGGGAAAAGAGGG + Intergenic
965055497 3:163708528-163708550 TTGTAGCTAGAGTGAAAACATGG - Intergenic
965259562 3:166463838-166463860 CTGATGTTAGAGGGAAAAAAAGG + Intergenic
966094477 3:176183025-176183047 CTGTGCATAAAGTGAAAAATTGG + Intergenic
967443896 3:189542394-189542416 GTGTGTGTAGACTGAGAAAAGGG - Intergenic
969208011 4:5663470-5663492 GTGTGGGTAAAGTGGAACAATGG + Intronic
970083406 4:12316368-12316390 CTGTGGGGATAGAAAAAAAATGG - Intergenic
970105783 4:12581800-12581822 GTGGGGGTAGAGAGAACAAAGGG + Intergenic
970662403 4:18300546-18300568 TTTTTGGTAGACTGAAAAAATGG + Intergenic
973764170 4:54148827-54148849 ATGTGGGTGGAGTGAGATAAGGG - Intronic
974122178 4:57652602-57652624 TTATGGGTAGAGTGGAAGAAAGG - Intergenic
974568193 4:63606935-63606957 CTGTGGGGAGAATGAGAAACAGG - Intergenic
976432018 4:84973220-84973242 CTGTGGGTAGACTAGATAAAAGG - Intergenic
976471370 4:85432819-85432841 CTATGTGTATAGTGAAAAAATGG + Intergenic
977711401 4:100130255-100130277 CTTTTGGTACAGTGAAAGAATGG - Intergenic
978758167 4:112326521-112326543 CTGTGGAGAGAGAGAAAGAAAGG + Intronic
979797713 4:124867711-124867733 GTGTGGATACAGTGGAAAAAGGG + Intergenic
981558822 4:146024773-146024795 CTGGGGGGAGAGAGAAAGAATGG - Intergenic
981904603 4:149907154-149907176 CAACAGGTAGAGTGAAAAAAAGG + Intergenic
981950633 4:150402633-150402655 CTGTTAGTGGAGAGAAAAAATGG + Intronic
982034068 4:151328036-151328058 CTGTGGGGAGACTCAAAAGAAGG + Intergenic
982988531 4:162241505-162241527 CTGTATGTTGAGTGAAAACAAGG - Intergenic
983222620 4:165056984-165057006 CTGTGAACAGAGTGAAAAATAGG + Intergenic
984041134 4:174735238-174735260 CTGTGGGTAGGAGAAAAAAATGG + Intronic
984914141 4:184705414-184705436 CTGTGGGTGTAGTTATAAAAGGG + Intronic
985025899 4:185738830-185738852 GTATGTGGAGAGTGAAAAAAAGG - Intronic
985182557 4:187280822-187280844 GCCTGGATAGAGTGAAAAAAAGG - Intergenic
986042481 5:4006860-4006882 TTGTTCATAGAGTGAAAAAAAGG - Intergenic
986393268 5:7304262-7304284 CTGTGGGGAGAGTCAAAGGAAGG + Intergenic
987488704 5:18551317-18551339 ATGTGGGTGGAGTCAAATAAGGG - Intergenic
988218316 5:28306740-28306762 ATGAGGTTAGAGTGAAAAGATGG + Intergenic
988370088 5:30357354-30357376 CTTGGGGTAGTATGAAAAAAAGG + Intergenic
988868029 5:35356739-35356761 GTGAGGGTAGGGTGAAAAAGTGG - Intergenic
989730702 5:44644584-44644606 GTGTGGGGAGAGAGAAAAAAAGG + Intergenic
990815289 5:59778097-59778119 CTGTGGGTCCAGTGAAGACATGG + Intronic
991172997 5:63650352-63650374 CTGTGGGTGGGGTGACAGAAAGG - Intergenic
991994018 5:72369771-72369793 CAGTGGGAAGTGTGAAAGAAAGG - Intergenic
992356390 5:75988814-75988836 CTGTCTGTAGAGTGAAAAGGGGG - Intergenic
992483217 5:77171665-77171687 GTGTGGGCAGGGTTAAAAAATGG + Intergenic
994476009 5:100270882-100270904 CTGTGGCTATAGCGAAAAAATGG - Intergenic
995932174 5:117459190-117459212 CTGTGATTTGAGTGACAAAAAGG - Intergenic
996814341 5:127558337-127558359 CTGTGAGTGGTGTGAAATAAGGG + Intergenic
997776538 5:136612966-136612988 CTTTGCATAGGGTGAAAAAAAGG - Intergenic
997890894 5:137675856-137675878 CTAAGTGTAGAGTGAGAAAATGG - Intronic
999808479 5:155106236-155106258 CTGCGGATAGAATGAGAAAAAGG + Intergenic
1000232569 5:159329811-159329833 CTGTGAGAAGGGGGAAAAAAAGG - Intronic
1000543749 5:162573062-162573084 ATGTGGGTATAGTTAGAAAATGG + Intergenic
1001525282 5:172424355-172424377 CTGTGGGTAGAGGGGAATGAGGG + Intronic
1001713926 5:173799326-173799348 CTGGGGGTAGAGTGCAAAGAGGG - Intergenic
1002086545 5:176779477-176779499 ATGCGGGGAGAGTGAAAAATGGG - Intergenic
1003576108 6:7296812-7296834 TTGTGGTTAGAGTAATAAAATGG - Intronic
1003619451 6:7685138-7685160 CTGTGTGACGAGTGGAAAAACGG + Intergenic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1005696042 6:28353751-28353773 CTGTGGATAGAGAAAAGAAAAGG + Intronic
1006247615 6:32753307-32753329 GTGTGGGGAGAGGGAGAAAAAGG + Intergenic
1007160408 6:39787372-39787394 CAGTGAGTAGAGTGCCAAAATGG - Intergenic
1007192683 6:40033019-40033041 CTGTGGGTAGAGGGAAAGGCAGG + Intergenic
1007440522 6:41855702-41855724 CAGTGGTGTGAGTGAAAAAAGGG - Intronic
1012532999 6:100261180-100261202 CTTTGGGTAGATTGAAAAAGGGG - Intergenic
1013425695 6:110010714-110010736 CTGTGGGCTGAGGGACAAAAGGG - Intergenic
1013535362 6:111058703-111058725 CAGTGGGCAGAGTCAAACAAAGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1015389629 6:132666699-132666721 CTGTGGGAAGTGTGAAATAAAGG - Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1016137746 6:140567055-140567077 CTGTGACTAGAGAGACAAAATGG - Intergenic
1017700611 6:157066085-157066107 CTGTGGGGAGACTAAACAAATGG - Intronic
1017709042 6:157149353-157149375 CTTGTGGTAGGGTGAAAAAAAGG - Intronic
1018303056 6:162424235-162424257 CTCAGGGTAGAGGGAAGAAATGG + Intronic
1018982071 6:168608567-168608589 ATGTAGGTAGAATGAATAAAGGG - Intronic
1020028533 7:4916768-4916790 CTGTGGACAAAGTGCAAAAATGG + Intronic
1021567146 7:22027025-22027047 GTGTGGGTAGAATGTAAACAAGG + Intergenic
1022980230 7:35598345-35598367 CTGTGATTAGACTGAAAGAAAGG + Intergenic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1023637648 7:42228359-42228381 CCGCGGGAAAAGTGAAAAAAGGG + Intronic
1024091421 7:45944745-45944767 TTGTGGGGAGAGTCAAAACACGG - Intergenic
1024820414 7:53322766-53322788 ATGTGGGTAGGGTCAAATAAGGG - Intergenic
1025825207 7:65005366-65005388 CTGTGGCTAGAGGCAATAAAAGG + Intronic
1026400590 7:70008846-70008868 CTTTGGGTAATATGAAAAAAAGG - Intronic
1026500065 7:70936500-70936522 CCCTGGGTATAGTGAAGAAAGGG - Intergenic
1027333549 7:77124544-77124566 GTTTTGGTAGAGTGATAAAAGGG - Intronic
1027803584 7:82786129-82786151 CAGTAGTTAGAATGAAAAAAAGG + Intronic
1028853236 7:95560438-95560460 CTGTGTGTAGGCTGAAAGAAAGG - Intergenic
1028869680 7:95755713-95755735 CAGTGGGTGGAGTGAAACCACGG + Intergenic
1029782245 7:102746780-102746802 GTTTTGGTAGAGTGATAAAAGGG + Intergenic
1030960295 7:115912062-115912084 CTTTGGGAAGAGTGAAAAGATGG - Intergenic
1031875296 7:127132796-127132818 CTGTGGCTAGAGTGGATGAACGG + Intronic
1032911665 7:136439188-136439210 CTGTAGGGAGAGTGAAGAAGTGG + Intergenic
1032912257 7:136446692-136446714 CTGTTAATAGAGTGAAAAATAGG + Intergenic
1034339921 7:150346295-150346317 CTGTGTGGAGAGTGGATAAAAGG + Intergenic
1035003702 7:155638924-155638946 GTGAGGTTAGAGTGAAAAGATGG - Intronic
1039847882 8:41338657-41338679 CAGTGGGGAGAAAGAAAAAAGGG + Intergenic
1042071252 8:64937466-64937488 CTTTGGTTAGAGAGTAAAAAGGG + Intergenic
1042616871 8:70659276-70659298 CTGTGGGTAGGGAGACCAAAAGG + Intronic
1042676490 8:71327638-71327660 GCGTGGGGAGAGTGAAAGAAAGG - Intronic
1042848963 8:73196810-73196832 CTGGGGTTAGATTGAGAAAAGGG + Intergenic
1044245360 8:89937935-89937957 ATGTGGGAAGAGGGAAAAAAAGG - Intronic
1044325288 8:90851564-90851586 TTGTGGGTATAGAAAAAAAAGGG + Intronic
1045031260 8:98138662-98138684 CTGGGGAGAGAGTGAAAAACAGG - Intronic
1045164346 8:99586611-99586633 TTGTGGGGAGAGGGAAAAGATGG + Intronic
1046440702 8:114249841-114249863 CTTTGGGGACAGCGAAAAAAAGG + Intergenic
1047289965 8:123521200-123521222 CTGGGGGTAGAGTGGGAAACAGG - Intronic
1047702449 8:127462808-127462830 GTGTGGGAAAAGAGAAAAAAAGG - Intergenic
1048246027 8:132800931-132800953 CTGTAGGTAGGGAGAAAAAGAGG - Intronic
1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG + Intergenic
1049291947 8:141808074-141808096 TTGTGGCTAGAGTGGAAAGAAGG + Intergenic
1049425088 8:142534373-142534395 CTCTGGGCAGAGTGAACAGAGGG + Intronic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1050719960 9:8577106-8577128 TGGTGGGGAGAGTGGAAAAAAGG - Intronic
1050998533 9:12250413-12250435 CTTTATGTTGAGTGAAAAAAAGG + Intergenic
1051377285 9:16415266-16415288 CTATGGAAAGAGAGAAAAAAAGG - Exonic
1052332470 9:27283700-27283722 CTGGGGGAAGAGAGAAAGAAGGG + Intergenic
1052800901 9:32967247-32967269 CTGTGTGTAGTTTGGAAAAAAGG + Intergenic
1052859390 9:33427520-33427542 CTGTGGGGAGAGAGAAAGGAAGG + Intergenic
1053051265 9:34962502-34962524 CTGATGGTAGAATGAACAAATGG - Intronic
1053119754 9:35537934-35537956 CTGTGGGAATAAGGAAAAAAGGG - Intronic
1055938622 9:81627344-81627366 CTGTGATTACAGTGAAAATAGGG - Intronic
1056053556 9:82796490-82796512 CTGAGGGTAGGGTGGAAGAAGGG + Intergenic
1056743469 9:89280095-89280117 TTGAGTGTAGAGTGAAAAACTGG + Intergenic
1058635452 9:107033920-107033942 ATGTGGGCAGAATGAGAAAATGG + Intergenic
1059213315 9:112535229-112535251 CAGTGGGATGACTGAAAAAATGG - Intronic
1059658411 9:116377553-116377575 CTGTGGGAAGAGGGAGAGAAAGG - Intronic
1059795935 9:117696895-117696917 CTGTGGGAGGACTGAAGAAAAGG + Intergenic
1059983320 9:119797219-119797241 CTGTGGGCAGAGTGAATCATGGG + Intergenic
1061010656 9:127952535-127952557 CTGTGGGTACAGTGAAACCCTGG + Intronic
1061294466 9:129669444-129669466 CTGTGGGCAGAGTGGAAACGGGG + Intronic
1186515554 X:10164079-10164101 CTGTGTGTTGAGTGAAAGGATGG + Intronic
1187298238 X:18023512-18023534 CTTTCTGTAGATTGAAAAAAAGG - Intergenic
1187619474 X:21034665-21034687 CCTTGGGCAGGGTGAAAAAATGG - Intergenic
1188223375 X:27567480-27567502 CTGTCTCTAGAGGGAAAAAAAGG - Intergenic
1188535385 X:31190972-31190994 CTGAGGGTAGAGAGAGCAAAAGG + Intronic
1189706297 X:43762197-43762219 CTATGGCTAGAGTAAAAAGATGG - Intergenic
1191904991 X:66077958-66077980 CTTTGGATAGAGTGGAAGAAAGG - Intergenic
1192409660 X:70922102-70922124 CAGTGGGTTGAGTGAATAGAGGG - Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1192769279 X:74170067-74170089 CTTTGAGTAGTGTGAAAAAGGGG + Intergenic
1194003046 X:88455835-88455857 CTGGGAGTAGATTTAAAAAATGG + Intergenic
1194521712 X:94927180-94927202 CTTAGGGAAGAGGGAAAAAATGG + Intergenic
1195089635 X:101446391-101446413 CTGTGGGCAGAATAAAACAAGGG + Intronic
1195114598 X:101684133-101684155 CTGTTGGTAGAGTGAAGAGAGGG + Intergenic
1195163966 X:102198923-102198945 GTGAGGTTAGAGTGAAAATATGG + Intergenic
1195194895 X:102488172-102488194 GTGAGGTTAGAGTGAAAATATGG - Intergenic
1198069626 X:133135188-133135210 CAGTGGGTATATTGAAGAAAAGG + Intergenic
1198144875 X:133845032-133845054 CTGTGAGGGGAGTGCAAAAAGGG - Intronic
1198410929 X:136367030-136367052 GTGAGGTTATAGTGAAAAAATGG + Intronic
1198447643 X:136734130-136734152 GGTTGGGTAGAGTGAAAATAAGG + Intronic
1201727703 Y:17171542-17171564 GTGTGGGAAGAGAGAAGAAAGGG + Intergenic
1202361711 Y:24117612-24117634 TGGGGGGTAGAGAGAAAAAAGGG - Intergenic
1202363362 Y:24135484-24135506 TGGGGGGTAGAGAGAAAAAAGGG + Intergenic
1202507418 Y:25534633-25534655 TGGGGGGTAGAGAGAAAAAAGGG - Intergenic
1202509067 Y:25552501-25552523 TGGGGGGTAGAGAGAAAAAAGGG + Intergenic