ID: 1133331069

View in Genome Browser
Species Human (GRCh38)
Location 16:4974429-4974451
Sequence TCGGAGAATCGCTTAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122094
Summary {0: 1, 1: 30, 2: 975, 3: 14717, 4: 106371}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133331069_1133331073 0 Left 1133331069 16:4974429-4974451 CCTGGGCTTAAGCGATTCTCCGA 0: 1
1: 30
2: 975
3: 14717
4: 106371
Right 1133331073 16:4974452-4974474 CCTCGACCTCCCAAAGTGCTGGG 0: 3567
1: 131954
2: 279099
3: 207573
4: 119987
1133331069_1133331071 -1 Left 1133331069 16:4974429-4974451 CCTGGGCTTAAGCGATTCTCCGA 0: 1
1: 30
2: 975
3: 14717
4: 106371
Right 1133331071 16:4974451-4974473 ACCTCGACCTCCCAAAGTGCTGG 0: 1213
1: 40702
2: 183890
3: 256421
4: 172051
1133331069_1133331077 9 Left 1133331069 16:4974429-4974451 CCTGGGCTTAAGCGATTCTCCGA 0: 1
1: 30
2: 975
3: 14717
4: 106371
Right 1133331077 16:4974461-4974483 CCCAAAGTGCTGGGATTACAGGG 0: 3844
1: 4167
2: 2966
3: 3317
4: 4349
1133331069_1133331075 8 Left 1133331069 16:4974429-4974451 CCTGGGCTTAAGCGATTCTCCGA 0: 1
1: 30
2: 975
3: 14717
4: 106371
Right 1133331075 16:4974460-4974482 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
1133331069_1133331079 26 Left 1133331069 16:4974429-4974451 CCTGGGCTTAAGCGATTCTCCGA 0: 1
1: 30
2: 975
3: 14717
4: 106371
Right 1133331079 16:4974478-4974500 ACAGGGTGAGCCACCGTGCCTGG 0: 18
1: 127
2: 457
3: 2088
4: 25629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133331069 Original CRISPR TCGGAGAATCGCTTAAGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr