ID: 1133331071

View in Genome Browser
Species Human (GRCh38)
Location 16:4974451-4974473
Sequence ACCTCGACCTCCCAAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 654277
Summary {0: 1213, 1: 40702, 2: 183890, 3: 256421, 4: 172051}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133331066_1133331071 17 Left 1133331066 16:4974411-4974433 CCAGGCTGGTCTTGAACGCCTGG 0: 80
1: 18827
2: 90316
3: 160705
4: 182814
Right 1133331071 16:4974451-4974473 ACCTCGACCTCCCAAAGTGCTGG 0: 1213
1: 40702
2: 183890
3: 256421
4: 172051
1133331065_1133331071 18 Left 1133331065 16:4974410-4974432 CCCAGGCTGGTCTTGAACGCCTG 0: 81
1: 18859
2: 38218
3: 57717
4: 51393
Right 1133331071 16:4974451-4974473 ACCTCGACCTCCCAAAGTGCTGG 0: 1213
1: 40702
2: 183890
3: 256421
4: 172051
1133331069_1133331071 -1 Left 1133331069 16:4974429-4974451 CCTGGGCTTAAGCGATTCTCCGA 0: 1
1: 30
2: 975
3: 14717
4: 106371
Right 1133331071 16:4974451-4974473 ACCTCGACCTCCCAAAGTGCTGG 0: 1213
1: 40702
2: 183890
3: 256421
4: 172051

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133331071 Original CRISPR ACCTCGACCTCCCAAAGTGC TGG Intronic
Too many off-targets to display for this crispr