ID: 1133331077

View in Genome Browser
Species Human (GRCh38)
Location 16:4974461-4974483
Sequence CCCAAAGTGCTGGGATTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18643
Summary {0: 3844, 1: 4167, 2: 2966, 3: 3317, 4: 4349}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133331066_1133331077 27 Left 1133331066 16:4974411-4974433 CCAGGCTGGTCTTGAACGCCTGG 0: 80
1: 18827
2: 90316
3: 160705
4: 182814
Right 1133331077 16:4974461-4974483 CCCAAAGTGCTGGGATTACAGGG 0: 3844
1: 4167
2: 2966
3: 3317
4: 4349
1133331069_1133331077 9 Left 1133331069 16:4974429-4974451 CCTGGGCTTAAGCGATTCTCCGA 0: 1
1: 30
2: 975
3: 14717
4: 106371
Right 1133331077 16:4974461-4974483 CCCAAAGTGCTGGGATTACAGGG 0: 3844
1: 4167
2: 2966
3: 3317
4: 4349
1133331070_1133331077 -10 Left 1133331070 16:4974448-4974470 CCGACCTCGACCTCCCAAAGTGC 0: 1283
1: 42676
2: 192034
3: 269723
4: 180375
Right 1133331077 16:4974461-4974483 CCCAAAGTGCTGGGATTACAGGG 0: 3844
1: 4167
2: 2966
3: 3317
4: 4349
1133331065_1133331077 28 Left 1133331065 16:4974410-4974432 CCCAGGCTGGTCTTGAACGCCTG 0: 81
1: 18859
2: 38218
3: 57717
4: 51393
Right 1133331077 16:4974461-4974483 CCCAAAGTGCTGGGATTACAGGG 0: 3844
1: 4167
2: 2966
3: 3317
4: 4349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133331077 Original CRISPR CCCAAAGTGCTGGGATTACA GGG Intronic
Too many off-targets to display for this crispr