ID: 1133331079

View in Genome Browser
Species Human (GRCh38)
Location 16:4974478-4974500
Sequence ACAGGGTGAGCCACCGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28319
Summary {0: 18, 1: 127, 2: 457, 3: 2088, 4: 25629}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133331076_1133331079 -6 Left 1133331076 16:4974461-4974483 CCCAAAGTGCTGGGATTACAGGG 0: 3574
1: 298705
2: 273637
3: 155315
4: 139595
Right 1133331079 16:4974478-4974500 ACAGGGTGAGCCACCGTGCCTGG 0: 18
1: 127
2: 457
3: 2088
4: 25629
1133331072_1133331079 3 Left 1133331072 16:4974452-4974474 CCTCGACCTCCCAAAGTGCTGGG 0: 3341
1: 124982
2: 268208
3: 211109
4: 126311
Right 1133331079 16:4974478-4974500 ACAGGGTGAGCCACCGTGCCTGG 0: 18
1: 127
2: 457
3: 2088
4: 25629
1133331069_1133331079 26 Left 1133331069 16:4974429-4974451 CCTGGGCTTAAGCGATTCTCCGA 0: 1
1: 30
2: 975
3: 14717
4: 106371
Right 1133331079 16:4974478-4974500 ACAGGGTGAGCCACCGTGCCTGG 0: 18
1: 127
2: 457
3: 2088
4: 25629
1133331074_1133331079 -3 Left 1133331074 16:4974458-4974480 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1133331079 16:4974478-4974500 ACAGGGTGAGCCACCGTGCCTGG 0: 18
1: 127
2: 457
3: 2088
4: 25629
1133331070_1133331079 7 Left 1133331070 16:4974448-4974470 CCGACCTCGACCTCCCAAAGTGC 0: 1283
1: 42676
2: 192034
3: 269723
4: 180375
Right 1133331079 16:4974478-4974500 ACAGGGTGAGCCACCGTGCCTGG 0: 18
1: 127
2: 457
3: 2088
4: 25629
1133331078_1133331079 -7 Left 1133331078 16:4974462-4974484 CCAAAGTGCTGGGATTACAGGGT 0: 305
1: 11871
2: 308390
3: 271822
4: 157201
Right 1133331079 16:4974478-4974500 ACAGGGTGAGCCACCGTGCCTGG 0: 18
1: 127
2: 457
3: 2088
4: 25629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133331079 Original CRISPR ACAGGGTGAGCCACCGTGCC TGG Intronic
Too many off-targets to display for this crispr