ID: 1133332169

View in Genome Browser
Species Human (GRCh38)
Location 16:4981584-4981606
Sequence GAGCCAGGCACTGTCCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 358}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133332169_1133332174 24 Left 1133332169 16:4981584-4981606 CCCGGGGGGACAGTGCCTGGCTC 0: 1
1: 0
2: 1
3: 48
4: 358
Right 1133332174 16:4981631-4981653 AAGCCCAGCTGCTGAGCAAACGG 0: 1
1: 0
2: 2
3: 18
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133332169 Original CRISPR GAGCCAGGCACTGTCCCCCC GGG (reversed) Intronic
900162268 1:1229638-1229660 GGGCCCGGCTCTGTCCCTCCTGG + Intronic
900431829 1:2606366-2606388 GTGCGGGGCACTGTCTCCCCAGG - Exonic
900506305 1:3031309-3031331 GAGCCCAGCCCTGTCCCCCGTGG - Intergenic
900565267 1:3329006-3329028 CAGCCAGACCCTTTCCCCCCAGG + Intronic
900622089 1:3592171-3592193 GAGGCTGGCACGGTGCCCCCAGG + Intronic
900636394 1:3668084-3668106 GAGCCAGGCACCAGCCTCCCTGG + Intronic
901332698 1:8423527-8423549 GAGCCAGGAGCTGCCCCCACCGG - Intronic
901440407 1:9274508-9274530 GAGTCTCGCTCTGTCCCCCCAGG - Intergenic
901672374 1:10863384-10863406 GAGCCCCTCACTGTCCACCCGGG + Intergenic
902232191 1:15035108-15035130 GAGCCAGGATCTGAACCCCCCGG - Intronic
902849250 1:19140842-19140864 GAGCCTGGGACTGTCCGGCCAGG - Exonic
903919862 1:26792176-26792198 GAGTCTCGCCCTGTCCCCCCAGG + Intronic
904295618 1:29517936-29517958 GGGCCAGGCCATGTCCACCCAGG + Intergenic
905873802 1:41419471-41419493 CAGCCTGGCACTGCCCCCACTGG + Intergenic
906545323 1:46616120-46616142 GAGCAAGGCACTGCCACTCCAGG - Intronic
907381481 1:54094505-54094527 AAGCCAGGCACTGCCCTCCTGGG + Intronic
907455955 1:54575601-54575623 GAGCCAGGCTCTGTCCCCTCTGG + Intronic
914195417 1:145445838-145445860 GAGCCAGGGCCCTTCCCCCCAGG - Intergenic
914800047 1:150954295-150954317 GAGTCATGCTCTGTCACCCCAGG - Intronic
915280099 1:154816610-154816632 GAGCCAGGCACTTCCTCCCAGGG + Intronic
915380230 1:155433517-155433539 GAGCCCTGCACCGTCCCCCCTGG + Intronic
915625109 1:157109620-157109642 GACCCAGGCACTGGACTCCCGGG + Intergenic
917649919 1:177066225-177066247 GAGCCAGGCCATGTTCCCACTGG + Intronic
917789736 1:178491956-178491978 GAGCCAGTCACCCTCCCCTCTGG + Intergenic
917929476 1:179813650-179813672 GTGCCAGGCACTGAACCCCAGGG - Intronic
920347113 1:205313614-205313636 GAGTCTGTCACTGTCCCCCTGGG + Intronic
922339392 1:224643477-224643499 GACCCACTCACTGTCCCACCAGG - Intronic
923562490 1:235051774-235051796 GAGACAGACACTGTCACACCAGG + Intergenic
923572153 1:235126159-235126181 GAGTCTTGCTCTGTCCCCCCAGG + Intronic
923918455 1:238535975-238535997 GACTCAGGCTCTGTCACCCCGGG - Intergenic
924648834 1:245904800-245904822 GAGCCAGGTGCTGTGCACCCTGG - Intronic
924710188 1:246524831-246524853 GTGCCAGGCACTTTCCCCACAGG - Intergenic
1063452278 10:6158261-6158283 GAGTCTTGCTCTGTCCCCCCAGG - Intronic
1065197970 10:23285159-23285181 GAGACAGGCACTGGCCCCAGGGG + Intronic
1067061836 10:43081710-43081732 GACCCAGGCACTGCACCCCTTGG + Intronic
1068010040 10:51436958-51436980 TAGCCAGGCCTTGTCACCCCTGG + Intronic
1069849999 10:71398100-71398122 AAGCCAGGCAGAGTCCCCGCCGG - Intronic
1069873124 10:71545231-71545253 GAGACAGGCACCGTGCTCCCAGG + Intronic
1070570241 10:77635912-77635934 GAGACAGGCTCCTTCCCCCCTGG + Intronic
1071480935 10:86064490-86064512 GAGGCAGGCACTGTGCCCTCAGG - Intronic
1071651465 10:87396835-87396857 CAGCCATGCACTGCCACCCCTGG + Intergenic
1071848270 10:89542009-89542031 GAGAAAGGCACTATCGCCCCTGG - Intronic
1071978234 10:90976717-90976739 GATCCAGGCACAGTCCTCCCAGG - Intergenic
1072457772 10:95591867-95591889 GAGTCTGGCTCTGTCGCCCCAGG + Intergenic
1073291567 10:102415883-102415905 GAGTCAGCCAATGTCTCCCCAGG - Intronic
1074116406 10:110460292-110460314 GAGCCAGGCTCTGCCTCCCACGG + Intergenic
1074817388 10:117152769-117152791 GAGACAGGCACTGCCACACCAGG + Intergenic
1074961576 10:118450495-118450517 GAGTTAGACACTGTCTCCCCAGG + Intergenic
1075880177 10:125844375-125844397 CAGCCAGGCTCTGTCCCCAAAGG + Intronic
1076511850 10:131019819-131019841 CAGCCATGCCCTGTGCCCCCCGG + Intergenic
1076805643 10:132857265-132857287 GAGCCAGGCACTGCCACTCATGG - Intronic
1077030216 11:462163-462185 AAGCCAGGCCCTGCCCTCCCAGG + Intronic
1077096762 11:802259-802281 GAGCCAGGCCTCGTCCCCCTGGG - Exonic
1078619494 11:12893957-12893979 CAGCCATTCCCTGTCCCCCCAGG + Intronic
1078667678 11:13339922-13339944 GTGCCAGGCACTGTTCTCCATGG - Intronic
1078921034 11:15830877-15830899 AAGCCAGGCACTGTGCAGCCTGG - Intergenic
1079056171 11:17208131-17208153 GAGCCAGACCCTGGTCCCCCGGG - Intronic
1081654611 11:44849228-44849250 GAGACAGACACAGTCCCTCCTGG - Intronic
1081976455 11:47238422-47238444 GAGTCTCGCTCTGTCCCCCCGGG + Intronic
1082813972 11:57496186-57496208 GGGCCAGGCAGTCTCCCCCACGG - Intronic
1083486909 11:62988801-62988823 GAGCCAGGAACTGTCCCTTAGGG + Intergenic
1083958921 11:66003123-66003145 GAGCAAGCCACTGTAACCCCTGG + Intronic
1084261909 11:67984314-67984336 GAGCCAGCCACTCTCTCCCCCGG - Intergenic
1084489769 11:69471899-69471921 GAGCAAGGCAGTGTCGCCCCAGG - Intergenic
1084673868 11:70623207-70623229 GAGGCAGGCACAGGCCCCACAGG - Intronic
1084810671 11:71609110-71609132 GAGCCAGCCCCTCTCCCCCCTGG - Intergenic
1085524863 11:77158206-77158228 CAGCCAGGCACTGCCCCTCTGGG + Intronic
1089454139 11:118616037-118616059 GAGCCAATCACCGTCCTCCCTGG - Exonic
1089477849 11:118780086-118780108 GAGTCTGGCTCTGTCCCCCCAGG - Intronic
1089500924 11:118930716-118930738 GATACAGGCCCTGTCCTCCCAGG + Intronic
1090465104 11:126926436-126926458 GAGCCACGCACCTTCCTCCCTGG + Intronic
1090484306 11:127098859-127098881 GGGCCAGGAACTGTCCAGCCAGG - Intergenic
1090869108 11:130726990-130727012 GAGGTAGACACTGTCCACCCAGG - Intergenic
1091137394 11:133204030-133204052 GAGTCTCGCTCTGTCCCCCCAGG - Intronic
1091398383 12:168382-168404 CAGGCAGGCTCTGTCCTCCCAGG + Intronic
1091794253 12:3288314-3288336 CAGCCAGTGACTGTCCCCCAGGG - Intergenic
1091829452 12:3539358-3539380 GAGTCAGGCACTGTGGCTCCAGG + Intronic
1092396831 12:8134493-8134515 GAGCCCTGCACCGTCCCCTCTGG - Intronic
1092538104 12:9405046-9405068 GAGCCAGCGCCTTTCCCCCCGGG + Intergenic
1092538479 12:9406004-9406026 GAGCCAGCGCCTTTCCCCCCCGG + Intergenic
1093438616 12:19166562-19166584 GATCCAGGAACTTTCCTCCCTGG + Intronic
1094209970 12:27878513-27878535 GAGTCTGGCTCTGTCCCCCCAGG - Intergenic
1094661087 12:32471228-32471250 GAGCCAGGCACTGGCATCCCTGG + Intronic
1095371344 12:41470831-41470853 GAGCCAGGGACTGTACCTCCTGG - Intronic
1097938523 12:65278986-65279008 GAGGCAGGGGCTGTCCCCGCAGG - Intronic
1102200214 12:111052916-111052938 GTGGCAGGCACTGCCTCCCCAGG + Intronic
1102454369 12:113062787-113062809 AAGCCAGGCTCTGGCCCCACAGG + Intronic
1102551803 12:113696748-113696770 GAGCAAATCACTGTCCCCACTGG - Intergenic
1103387931 12:120548683-120548705 GAGTCTCGCTCTGTCCCCCCAGG + Intronic
1104625924 12:130354606-130354628 GGCCCTGGCAGTGTCCCCCCAGG - Exonic
1104879965 12:132063951-132063973 GAGCCGGGCTTTGACCCCCCCGG + Intronic
1104926651 12:132317332-132317354 GAGCCTTGCACTGCCCCCCCAGG + Intronic
1104931671 12:132342388-132342410 GAGGCCGGCAGTGTCCCCTCAGG + Intergenic
1104961768 12:132491481-132491503 GGGGCAGGCGCTGTCTCCCCAGG + Intronic
1104978310 12:132561833-132561855 GAACCAGGCACTGAACACCCAGG - Intronic
1107078464 13:36348268-36348290 GAGCCAGACCCTGTACCCCCTGG + Intronic
1107987800 13:45790739-45790761 GTGCCAGCCACTGTCCCACCTGG + Intronic
1110326377 13:74221028-74221050 GAGTCTGGCTCTGTCGCCCCAGG + Intergenic
1110968305 13:81729095-81729117 GAGTCTGGCTCTGTCGCCCCAGG - Intergenic
1113526647 13:110984301-110984323 GAAACAGCCACTATCCCCCCTGG - Intergenic
1115648262 14:35385021-35385043 GGGGCAGTCACTGACCCCCCTGG + Intergenic
1117038036 14:51746951-51746973 GAGCCAGCCCCTATCCCCCCCGG + Intergenic
1117978336 14:61319874-61319896 AAGACAGGCCCTTTCCCCCCTGG + Intronic
1119296003 14:73533651-73533673 GAGTCTTGCTCTGTCCCCCCAGG - Intronic
1119704869 14:76777188-76777210 GGGGAAGGCACTGTCACCCCAGG - Intronic
1119713417 14:76840231-76840253 GAGCCCAGGACTGGCCCCCCTGG + Intronic
1121306207 14:92909113-92909135 GAGACAGTCTCTGTCACCCCAGG + Intergenic
1121624087 14:95371944-95371966 GGGACAGGCACTCTCTCCCCAGG - Intergenic
1121981629 14:98459583-98459605 GAGCCAGACAATGCCTCCCCAGG - Intergenic
1122140686 14:99661097-99661119 GAGTCAGGCTCTGTCCCCAAGGG + Intronic
1122825719 14:104369531-104369553 GAGCCAGGCCCAGCCCCACCAGG + Intergenic
1122969699 14:105147576-105147598 GTGCCAGGCACTGTCCAGGCTGG + Intronic
1123786764 15:23682503-23682525 GAGTCTGGCTCTGTCGCCCCAGG + Intergenic
1123914149 15:25004982-25005004 GAGTCACGCTCTGTCGCCCCAGG + Intergenic
1125692869 15:41610941-41610963 GAGTCTCGCACTGTCGCCCCGGG + Intergenic
1126821919 15:52512991-52513013 GAGCCAGACTCTGTCTCCACAGG + Intronic
1127958154 15:63870930-63870952 GAGCCAAGCTTTGTCCTCCCTGG - Intergenic
1128205732 15:65850170-65850192 GAGTCTCGCTCTGTCCCCCCAGG - Intronic
1128454968 15:67827153-67827175 GAGCCAGCCACTTGCCCCCGGGG + Intronic
1129843626 15:78758372-78758394 GGGGCGGACACTGTCCCCCCAGG - Intergenic
1130211818 15:81930902-81930924 GAGACAGGCACTGACACCCATGG + Intergenic
1130538262 15:84802366-84802388 CAGCCACACACTGTCCCCTCAGG + Exonic
1130903293 15:88223182-88223204 GAAGCAGTCACTGTCCGCCCTGG - Intronic
1131111306 15:89766804-89766826 CAGCCAGGCAGTGTTCCCACTGG + Intronic
1131131597 15:89903952-89903974 GAGCCTGTCAGTGTCCCCCTTGG + Exonic
1131468186 15:92672603-92672625 GACCCAGGCACTGCCCCACCTGG + Intronic
1132731216 16:1362915-1362937 GAGCCTGGCCCTCTCCCCACAGG - Intronic
1132878053 16:2148981-2149003 GAGCCAGGCACCCGCCCCCCAGG + Intronic
1133035262 16:3030749-3030771 GAGCCTGGCACTGTCCCCGAAGG + Exonic
1133317399 16:4893155-4893177 GAGCCCTGCACTGGCCCCCTGGG - Intronic
1133332169 16:4981584-4981606 GAGCCAGGCACTGTCCCCCCGGG - Intronic
1134018844 16:10907640-10907662 GAGCCAGCCACAGGGCCCCCAGG - Exonic
1134099232 16:11439884-11439906 GAACCAGGCACTGTGCTACCAGG + Intronic
1136104555 16:28020565-28020587 CAGCCAGCCACTGTGACCCCTGG + Intronic
1136272783 16:29158420-29158442 GAGGCAGGCAGTGGCTCCCCTGG - Intergenic
1136542729 16:30937355-30937377 AGGTCAGGCATTGTCCCCCCAGG + Intronic
1137610213 16:49812901-49812923 CAGCCACCCACTGTCCTCCCTGG - Intronic
1137720696 16:50625809-50625831 AGCCCAGGCACTGTCCCTCCCGG + Intronic
1138490401 16:57372994-57373016 GAGCCAGCCACTGTCAGCCAGGG - Intronic
1139687603 16:68616569-68616591 GAGCCAGAAACTGTTCCCCAGGG + Intergenic
1139711103 16:68777097-68777119 GAGAAAGCCACAGTCCCCCCAGG + Intronic
1140722066 16:77780951-77780973 GAGTCTGGCTCTGTCACCCCAGG - Intergenic
1141726787 16:85794926-85794948 CAGGCAGTCACTGTCCCCTCTGG + Intronic
1141894118 16:86947531-86947553 GAGCCAGGCACTGAGCTACCCGG + Intergenic
1142076340 16:88120232-88120254 GAGGCAGGCAGTGGCTCCCCTGG - Intergenic
1142141866 16:88476142-88476164 GAGCCAGGCTGAGTCCCACCTGG - Intronic
1142191623 16:88720779-88720801 GAGCCAGGCCCAGTCCCCAGGGG - Intronic
1142240876 16:88944454-88944476 GAGCCAGGCACGGTCTCCCAGGG - Intronic
1142590568 17:1003809-1003831 GAGCCAGGGACTGTGCAGCCTGG - Exonic
1142770636 17:2094274-2094296 GAGTCTGGCTCTGTCACCCCAGG + Intronic
1142808188 17:2382632-2382654 GTGCCAGGCCCTGTGCCCACTGG - Intergenic
1142984824 17:3689433-3689455 GAGCCAGGCCCAGTGCCCCCAGG + Intronic
1143457368 17:7076892-7076914 GATCCAGGCACTGACTTCCCAGG - Exonic
1144301058 17:13923309-13923331 GAGCCAGGGGCTCTTCCCCCAGG + Intergenic
1144737817 17:17564710-17564732 CTGCTAGGCACTGTCCCCCTTGG - Intronic
1144941092 17:18941564-18941586 GAGTCTGGCTCTGTCCCCCCAGG + Intergenic
1145057966 17:19715429-19715451 GCGCCAGGCACTGACCCTTCTGG - Intronic
1145759370 17:27417444-27417466 GTGCCGGGCACTTTCCCCACAGG + Intergenic
1145799676 17:27674907-27674929 GTGCCGGGCACTTTCCCCACAGG - Intergenic
1146269006 17:31472317-31472339 GAACCAGCCACTCTCTCCCCAGG - Intronic
1146857351 17:36265043-36265065 GTGCCCGGCACTTTCCCCACAGG - Intronic
1146863268 17:36323332-36323354 GTGCCCGGCACTTTCCCCACAGG + Intronic
1146873263 17:36388953-36388975 GTGCCCGGCACTTTCCCCACAGG - Intronic
1146921523 17:36715997-36716019 GAGCCATGAAATGGCCCCCCAGG + Intergenic
1147066128 17:37923920-37923942 GTGCCCGGCACTTTCCCCACAGG + Intergenic
1147076143 17:37989578-37989600 GTGCCCGGCACTTTCCCCACAGG - Intronic
1147077660 17:38003481-38003503 GTGCCCGGCACTTTCCCCACAGG + Intronic
1147087668 17:38069124-38069146 GTGCCCGGCACTTTCCCCACAGG - Intergenic
1147093596 17:38127415-38127437 GTGCCCGGCACTTTCCCCACAGG + Intergenic
1147103610 17:38193073-38193095 GTGCCCGGCACTTTCCCCACAGG - Intergenic
1147240759 17:39089172-39089194 GGGCCAGGCACAGTACCCCAAGG - Intronic
1147719187 17:42527914-42527936 GAGTCTGGCTCTGTCCCCCATGG - Intergenic
1148384085 17:47221983-47222005 GATCCAGGCCCTGTCTCCCTGGG + Intronic
1148812397 17:50301952-50301974 GTGCCAAGCTCTGTCCCACCTGG + Intergenic
1149861982 17:60126930-60126952 GTGCCCGGCACTTTCCCCACAGG + Intergenic
1149907771 17:60542484-60542506 GAGCCTCGCTCTGTCCCCCAGGG + Intergenic
1150130787 17:62667536-62667558 GAGCCAGGGACTGTGCCGCAGGG + Intronic
1150476450 17:65479427-65479449 GTGCCAGGCACTGTCCTCCAGGG + Intergenic
1151230216 17:72679473-72679495 GAGAAAGGCACTAACCCCCCAGG + Intronic
1151401391 17:73858107-73858129 ATGCCAGGCTCTGTCCCTCCTGG + Intergenic
1151553572 17:74835584-74835606 GAGCCAGGCAGTGCCTGCCCAGG + Intronic
1151919819 17:77145824-77145846 GAGCCAGGCACAGTCCCACAGGG - Intronic
1152424144 17:80209939-80209961 GAGCCAGGCGCCGTGCTCCCAGG + Exonic
1152923459 17:83077241-83077263 GAGCCTGGCCCTTTCCACCCTGG - Intergenic
1152934316 17:83127367-83127389 GAGGCAGGCAATGGCCCCTCCGG + Intergenic
1152945938 17:83197346-83197368 GACACAGGGACTGTCCCGCCCGG + Intergenic
1153244544 18:3060934-3060956 GGGTCAGGCCCTGTTCCCCCAGG - Intergenic
1153782297 18:8505312-8505334 CTGACAGGCACTGTCCCTCCGGG - Intergenic
1154292767 18:13124552-13124574 GAGCCAGGCACTGTGCTGCCTGG + Intronic
1155149963 18:23115341-23115363 CAGGCAGGCACTGTGCCCCCAGG + Intergenic
1156116665 18:33794244-33794266 TAGGCAGGCACTGTGTCCCCAGG - Intergenic
1156463535 18:37334724-37334746 GAGAAAGGAGCTGTCCCCCCCGG - Intronic
1157154648 18:45254117-45254139 CAGCCAGGCAGTGTCCATCCTGG + Intronic
1158436122 18:57436376-57436398 GAGCCAGAGCCTGTCCCCGCTGG + Exonic
1158522135 18:58180312-58180334 GAGCCAAGGACTGTGCACCCGGG - Intronic
1159799353 18:72878546-72878568 CAGCCAGGCAATCTCCCTCCTGG - Intergenic
1160095743 18:75870924-75870946 GAGTCTTGCACTGTCACCCCGGG - Intergenic
1160731853 19:644824-644846 GAGCCAGGCAGTGACACCCTGGG + Intergenic
1160802383 19:976425-976447 CAGCCAGGGTCTGTGCCCCCAGG + Intergenic
1160854002 19:1207806-1207828 GAGGGAGGCACAGTCCCCCTCGG - Intronic
1160979783 19:1811666-1811688 GAGCCAAGCCCTGCCCCACCAGG - Exonic
1161068431 19:2249214-2249236 GCGCCGGGCACTGTCCCCCAAGG + Intergenic
1161093385 19:2374939-2374961 GAGCCAAGTTCTGTGCCCCCTGG - Intergenic
1161398699 19:4058401-4058423 GGGACAGACACAGTCCCCCCAGG - Intronic
1162513436 19:11133890-11133912 GAGCCTGGCTCTGTCACCCCTGG + Intronic
1162626193 19:11887119-11887141 GAGCCTCGCTCTGTCCCCCCAGG - Intergenic
1163139504 19:15336995-15337017 GAGCCTCGCTCTGTCCACCCAGG - Intergenic
1163416285 19:17188507-17188529 GAACCAGGCGCTGTCACCTCTGG - Intronic
1164914917 19:32044773-32044795 GAGACAGGCTCTGTCCTCACTGG + Intergenic
1166137777 19:40787615-40787637 GACCCTGGCCCTGACCCCCCTGG - Intronic
1166190476 19:41173254-41173276 GTGCCAGGCACTGAGGCCCCAGG - Intergenic
1166253408 19:41586240-41586262 GACCCAGGATCTGTCCCCACTGG + Intronic
1166353993 19:42216628-42216650 GAGCCAGGCCCTTTCCTCCCAGG + Intronic
1166557892 19:43713547-43713569 CAGCCAGGCTCTGCCCCCACAGG - Intergenic
1167498217 19:49831330-49831352 CAGGCAGGCACTGTGGCCCCAGG + Exonic
1167521850 19:49960052-49960074 GAGCCACTCACTGTCCCGCTGGG + Intronic
1168523301 19:57069575-57069597 GAGTCTTGCTCTGTCCCCCCAGG + Intergenic
926305341 2:11633993-11634015 GTGCCCCGCACAGTCCCCCCAGG - Intronic
926339283 2:11891529-11891551 GTGGCAGGCACAGTCCCCCAAGG - Intergenic
927651650 2:24917169-24917191 GACCCAGGCACTGACCTCCATGG + Intronic
929219591 2:39449457-39449479 GAGTCTCGCTCTGTCCCCCCAGG - Intergenic
932091510 2:68809921-68809943 TAGCCAGGCAGTGTCCATCCTGG - Intronic
932280662 2:70489163-70489185 GAGCCAGGCACCCTCTCCCCAGG - Intronic
934649962 2:96085109-96085131 GCGCCTGGCACTGTCCCCCAGGG - Intergenic
934976537 2:98806500-98806522 GAGCCCGGCCCTGGCTCCCCGGG - Intronic
937299467 2:120830328-120830350 GTGCCAGGCACTATGCCCACAGG - Intronic
938017229 2:127877162-127877184 CAGCCAAGTACTGGCCCCCCAGG - Intronic
938311171 2:130288865-130288887 GAGCAAGGCCCTGTCCTCTCCGG - Intergenic
939151865 2:138482792-138482814 GAGCCTTGCTCTGTCACCCCAGG - Intergenic
940674349 2:156710465-156710487 GAGTCTCGCACTGTCGCCCCAGG + Intergenic
940904351 2:159155503-159155525 GAGGCAGCCACTGTTCCCTCAGG - Intronic
942723578 2:178982630-178982652 GAGCGAGGCACTGCCTCCCTCGG + Intronic
944571644 2:201050907-201050929 GAGTCTTGCTCTGTCCCCCCAGG - Intronic
945736601 2:213608708-213608730 GAGTCTCGCTCTGTCCCCCCAGG + Intronic
948469496 2:238167988-238168010 CAGCCAGGCCCTGGCACCCCTGG - Intronic
1169522707 20:6390511-6390533 GACCTAGGAACTGTCCTCCCAGG - Intergenic
1169553602 20:6726674-6726696 GAGCCAGGGAGTGACCCCCATGG - Intergenic
1169822055 20:9722584-9722606 GAGTCTCGCTCTGTCCCCCCAGG - Intronic
1170033377 20:11965767-11965789 GGGCCAGGCACTCTCTCCCAGGG + Intergenic
1170804475 20:19617663-19617685 GAGCCAGGGACTGTTCCCAGTGG + Intronic
1171006217 20:21467863-21467885 GGGCCAGGCACTGTCAGCCAGGG + Intergenic
1172409321 20:34710036-34710058 GAGCCTGGCTCTGTCCTCACAGG + Exonic
1172520358 20:35561937-35561959 CAGCCTGGTCCTGTCCCCCCAGG - Intergenic
1172898183 20:38315362-38315384 GAGCCAGGGAGTCTGCCCCCAGG + Intronic
1174434654 20:50497661-50497683 GAGCATCGCTCTGTCCCCCCAGG + Intergenic
1174576950 20:51543289-51543311 GAGCCAGACACTGTTGCCCTCGG + Intronic
1175072840 20:56349294-56349316 GAGCCTCGCTCTGTCACCCCAGG + Intergenic
1175119105 20:56704706-56704728 GAGCCATGCTCTGTCCTGCCTGG - Intergenic
1175259603 20:57666232-57666254 GAGACAGGCACAGTCCCTCTGGG + Intronic
1175863554 20:62162954-62162976 GAGGCAGGCCCAGGCCCCCCGGG - Intronic
1175967136 20:62665404-62665426 GAGCCAGGCACTGGTGCCTCAGG + Intronic
1176029425 20:63004952-63004974 GAGCCGGGCAGGGTGCCCCCGGG - Intergenic
1176093275 20:63328402-63328424 GAGCCGGGCACTGAGCCCCTGGG + Exonic
1176171363 20:63697782-63697804 GAGCCAGCCACCTTCCCCTCGGG - Intronic
1176215820 20:63947276-63947298 GGGCCAGGCTCTGTCCCCTAGGG + Intronic
1178303346 21:31470780-31470802 GAAACAGCCACTGTCTCCCCAGG + Intronic
1179722948 21:43325705-43325727 AACCCAGGCACTGGCTCCCCGGG + Intergenic
1179775539 21:43659574-43659596 CAGCCAGCCACCGTCCGCCCGGG - Exonic
1179815657 21:43904523-43904545 GAGCAGGGCACCGACCCCCCAGG - Intronic
1180244067 21:46534638-46534660 GAGCCCGGCACTGTGCCAGCAGG - Exonic
1180922443 22:19527996-19528018 GAGTCTGGCACTGTCCACTCTGG - Intergenic
1181114386 22:20621926-20621948 GAGCAGGGCACTGTCCCCACAGG - Intergenic
1181243254 22:21489329-21489351 GAGGCAGCCACTGTTCTCCCCGG + Intergenic
1181316714 22:21975267-21975289 GCCCCAGGCATTGTCACCCCTGG - Intronic
1182351462 22:29702400-29702422 GAGCCAGGCAGCGCCTCCCCAGG + Intergenic
1182555281 22:31125679-31125701 GAGCCTGGCACTCACTCCCCTGG + Exonic
1182708843 22:32307751-32307773 GGGCCATGCCCTGTCCCCTCCGG - Intergenic
1183478526 22:38050421-38050443 GAGCCAGCCACTGTGCTGCCAGG + Intergenic
1183486003 22:38088126-38088148 GAGCCAGGCAGTGCCCCCTCGGG - Intronic
1183714875 22:39527781-39527803 GTGACAGGCACTGTCCCACGAGG - Intergenic
1184351785 22:43949126-43949148 GAGCAAGACACTGTCCCCCATGG + Intronic
949883707 3:8679241-8679263 GAGCCAGCCAATTTTCCCCCTGG + Intronic
950119515 3:10472356-10472378 GAGACAGGCCCTCTCTCCCCTGG - Intronic
950706970 3:14788850-14788872 GAACCAGTCACTGTTGCCCCGGG + Intergenic
951072932 3:18353203-18353225 CAGCCAGTCACTGGCCACCCGGG - Intronic
953045506 3:39290893-39290915 GAGTCTCGCAGTGTCCCCCCAGG - Intergenic
954127573 3:48540473-48540495 CAGCCAGGCACTGACCCATCTGG + Intronic
954782631 3:53072600-53072622 GAGCCAGGCACTGTCTCTGTTGG + Intronic
955855133 3:63264785-63264807 GAGGCAGGCACTTTCCTCACAGG + Intronic
957895182 3:86412456-86412478 GAGTCTGGCTCTGTCACCCCAGG + Intergenic
959019275 3:101170521-101170543 GAGACAGGCACTATCTCCTCTGG - Intergenic
960993562 3:123326742-123326764 GAGCCAGGATCTGTCCCCTGGGG + Intronic
961748481 3:129081398-129081420 GAAGCAGCCACTGTGCCCCCAGG + Intergenic
962260007 3:133896007-133896029 CAGCGAGACACGGTCCCCCCCGG - Intergenic
962263021 3:133927046-133927068 ATTCCAGGCACTGTCCACCCCGG - Intergenic
962266185 3:133945883-133945905 GTGCCAGGCACTGTGCCCGGGGG + Intronic
962532574 3:136297347-136297369 GAGCCAAGAACTCTCTCCCCAGG - Intronic
962542085 3:136392737-136392759 GAGCCTGGCTCTGTCACCCAGGG - Intronic
962626941 3:137235186-137235208 GATCCAGCCACTGTACTCCCAGG - Intergenic
963041883 3:141076166-141076188 GAGCCAGGCTCGGTAACCCCAGG - Intronic
963055880 3:141185980-141186002 AGGCCAAGCACTGTCACCCCTGG + Intergenic
965365237 3:167790243-167790265 AAGCCTGGCACTTTTCCCCCAGG + Intronic
965549556 3:169950485-169950507 GAGTCCCGCTCTGTCCCCCCAGG + Intergenic
966793325 3:183692618-183692640 GACCCAGGCAGTCTGCCCCCAGG - Intergenic
967905677 3:194497699-194497721 GAGTCTCGCTCTGTCCCCCCAGG - Intronic
969022582 4:4147907-4147929 AAGCCAGCCCCTCTCCCCCCTGG - Intergenic
969188965 4:5501726-5501748 GAGCCAGGCACTGTCAGGACAGG - Intergenic
969733448 4:8971304-8971326 GAGCCAGCCCCACTCCCCCCCGG + Intergenic
969733478 4:8971383-8971405 GAGCCAGCCCCTATCCCCCCTGG + Intergenic
969793074 4:9505447-9505469 GAGCCAGCCCCTATCCCCCCTGG + Intergenic
975985690 4:80199614-80199636 CAGACAGGCACTTTCCCCCAAGG + Intronic
980121436 4:128732031-128732053 GAGTCTCGCTCTGTCCCCCCAGG - Intergenic
981423032 4:144572750-144572772 GGGCCTGGCACTGTCCCTCTGGG - Intergenic
982337396 4:154256170-154256192 GAGTCTGGCACTGTCACCCAGGG + Intronic
982446337 4:155495231-155495253 GAGTCTTGCTCTGTCCCCCCAGG + Intergenic
983866930 4:172778797-172778819 AAGTCAGGCACAGTCCCTCCTGG + Intronic
984512716 4:180698668-180698690 AAGCCAGGTACGGTCTCCCCAGG + Intergenic
985166197 4:187097360-187097382 GAGCCATGCTCTATCCCCTCAGG + Intergenic
986175671 5:5349914-5349936 GAAACGGGCAGTGTCCCCCCTGG - Intergenic
986283161 5:6339839-6339861 AAGCCCGGCACTGTCCCCCTGGG - Intergenic
986937796 5:12912907-12912929 TATCCAGGCACAGTCCCCCTGGG + Intergenic
988497287 5:31756178-31756200 GAGCCAGGCACAGGCACCCCCGG - Intronic
988675005 5:33424065-33424087 GAGCCAGTCACTGTGCCCACTGG - Intergenic
997414216 5:133712573-133712595 GAGCCAGGCACTGTTCTCAGGGG - Intergenic
997453238 5:134000166-134000188 GAACCAGGAACTGTTCCCCTGGG - Intronic
998781777 5:145664977-145664999 GAGCTAGACACTGGCCCCCATGG + Intronic
999277836 5:150343758-150343780 GAGTCTCGCTCTGTCCCCCCAGG + Intergenic
1001383277 5:171317810-171317832 AAGCCAGGCCATGTCCCCACTGG + Intergenic
1001683034 5:173572703-173572725 GAGCCAGCCATTGCTCCCCCTGG - Intergenic
1001747881 5:174105872-174105894 GAGTCTCGCTCTGTCCCCCCAGG - Intronic
1001906733 5:175479023-175479045 GGGCCAGGCACTGGGCCACCTGG - Intronic
1002106113 5:176880113-176880135 GCTCCAGGCACTGTCCCTCCTGG - Exonic
1002590617 5:180289655-180289677 GAGCCAGGCCCTGTTTGCCCAGG - Intronic
1002656623 5:180753679-180753701 AAGCCATGCACTGCCCCCCCAGG + Intergenic
1002690948 5:181050197-181050219 GAGGCAGGCACTGTCCCTGGTGG - Exonic
1002705184 5:181155893-181155915 GAGCCAGGCACTGGATGCCCTGG - Intergenic
1002797523 6:486830-486852 GAGCCGGGCACTGGCTCCCCTGG - Intronic
1002932578 6:1644603-1644625 GAGCCAGGTACCGTCCCACAGGG + Intronic
1006029710 6:31170262-31170284 GAGCCCTGCACCGTCACCCCTGG - Exonic
1006339974 6:33441538-33441560 GAGCTGGGCACTGAGCCCCCAGG + Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1011181244 6:84623603-84623625 TACCCAGGCACTATCTCCCCAGG + Intergenic
1011698260 6:89932601-89932623 GAGCCAGGCGCGGCTCCCCCCGG - Exonic
1012341621 6:98132355-98132377 GATACAGGCACTGTCCCCATGGG + Intergenic
1014254415 6:119147040-119147062 GAGCCTGCCACTGCCCCCGCTGG - Intronic
1017857467 6:158363034-158363056 GAGTCTCGCTCTGTCCCCCCAGG - Intronic
1018901039 6:168051851-168051873 GAGGCCGGCACTGTCCCCCTCGG - Intergenic
1018924260 6:168195387-168195409 GAGCCTGGCACTGCCCTCACCGG - Intergenic
1019064467 6:169285148-169285170 GAGCCAGGCACGGTCAGCTCAGG - Intergenic
1019164546 6:170089190-170089212 GAGTCTCGCTCTGTCCCCCCAGG - Intergenic
1019273075 7:161404-161426 GCACCAGGACCTGTCCCCCCAGG - Intergenic
1019344154 7:521402-521424 AAGCCAGGCCTTGTCCCTCCAGG + Intergenic
1019352584 7:561960-561982 CAGCCAGGCACTGTCCGTCCCGG + Intronic
1019408120 7:894525-894547 GTGGCAGGCCCTGTCCTCCCCGG + Intronic
1019875860 7:3809973-3809995 CAGCCATGCACAGTCCTCCCAGG + Intronic
1020006287 7:4785239-4785261 CAGCCCGGCCCTGTCCCACCTGG + Intronic
1020097559 7:5377250-5377272 GAGGCAGGCCCAGGCCCCCCAGG + Intronic
1020797747 7:12697238-12697260 GAGTCTCGCACTGTCACCCCGGG + Intergenic
1021873633 7:25028410-25028432 GCTCCAGGCACTGCCTCCCCAGG - Intergenic
1023669554 7:42561409-42561431 GAGGCATTCACAGTCCCCCCAGG + Intergenic
1024069243 7:45771930-45771952 GAGCCTGGCTCTGTCACCCATGG + Intergenic
1026842338 7:73676947-73676969 GAGTCTTGCTCTGTCCCCCCAGG - Intergenic
1026849468 7:73716013-73716035 GGGCCAGGCTCTGCCCCCACAGG + Intronic
1028773796 7:94656510-94656532 GAGCCAGGCGCGGTCTCCACTGG - Exonic
1029116245 7:98238807-98238829 GTGCCTGGCACTGTCCCACGAGG + Intronic
1029745943 7:102515985-102516007 GAACCAGGCACTGGGCTCCCAGG + Intronic
1029763881 7:102614964-102614986 GAACCAGGCACTGGGCTCCCAGG + Intronic
1033772311 7:144566127-144566149 GAGTCTGGCTCTGTCCCCCAGGG + Intronic
1034153647 7:148936628-148936650 GAGTCTTGCTCTGTCCCCCCAGG - Intergenic
1034741696 7:153479449-153479471 CAGCCAGCCACTGTCACCTCAGG + Intergenic
1034934503 7:155190107-155190129 GAGCCAGGGCCTGTCCCACGGGG - Intergenic
1034947594 7:155273359-155273381 GAACCATGCACGGTCCTCCCTGG - Intergenic
1034959351 7:155355382-155355404 GAGCCAGGCAGGGCACCCCCAGG + Intergenic
1035271896 7:157725260-157725282 GAGCCAGACCCTGGCCTCCCAGG + Intronic
1035402425 7:158576214-158576236 CAGCCAGGCACTGCCAGCCCGGG + Intronic
1035613951 8:988756-988778 GACCCAGGGCCTGTCCCCCGGGG + Intergenic
1035764453 8:2094623-2094645 GAGTCTTGCTCTGTCCCCCCAGG - Intronic
1036766561 8:11553331-11553353 GAGCCAGGCCCTGCCTGCCCAGG + Intronic
1037489852 8:19387677-19387699 AAGCCAGGCACTGTGGCCCCAGG - Intronic
1037639578 8:20730526-20730548 GACCCAGGCACTGTTCCCATTGG - Intergenic
1038489436 8:27959297-27959319 CAGCCTGGCACACTCCCCCCTGG + Intronic
1039116503 8:34096944-34096966 GACCGAGGCACTTTCTCCCCAGG - Intergenic
1039473545 8:37827745-37827767 GAGCCAGGCAGAGTCCACCTGGG + Intronic
1047697307 8:127416203-127416225 GAACCCTGCACCGTCCCCCCTGG + Exonic
1047874728 8:129123233-129123255 GAGTCTTGCACTGTCGCCCCAGG - Intergenic
1047933468 8:129752386-129752408 GACCCAGCCACTGTCCCCTGGGG - Intronic
1048204810 8:132406991-132407013 GAGCCAGCCCCTGTGCCCCAAGG + Intronic
1048663460 8:136633669-136633691 CCGCTAGGCACTGTACCCCCTGG + Intergenic
1049317867 8:141979219-141979241 GAGCCACGCACTGTCTGGCCAGG + Intergenic
1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG + Intronic
1049595784 8:143482722-143482744 GAGCCTGTCCCTGTCTCCCCAGG + Intronic
1049855868 8:144861543-144861565 GATCCAGACCCAGTCCCCCCTGG + Intergenic
1050018540 9:1260632-1260654 GATCCTGGCACTGACCCCTCTGG + Intergenic
1052870986 9:33506421-33506443 GAGTAAGGCTCTGTGCCCCCAGG + Intergenic
1053411100 9:37916609-37916631 GAGGCAGGCCCTGTCCTCACAGG - Intronic
1053736733 9:41107214-41107236 GAGCCAGCCGCTCTTCCCCCCGG + Intergenic
1056072719 9:83005923-83005945 CAGCCTGGCACTGTTCCACCAGG + Intronic
1056693611 9:88828091-88828113 GAGCGAGGGACTGACCTCCCAGG + Intergenic
1056918285 9:90763138-90763160 GAGCCAGCCCCTCTCCCCCCCGG - Intergenic
1057687530 9:97248930-97248952 GAGTAAGGCTCTGTGCCCCCAGG - Intergenic
1058249132 9:102669332-102669354 GAGCCATGCACTGTGCTGCCTGG + Intergenic
1060512074 9:124241490-124241512 GAGCAAGGCACAGACCCCTCTGG + Intergenic
1060547895 9:124471361-124471383 GAGCCTGGCACAGTCCAGCCTGG - Intronic
1061231970 9:129320473-129320495 AAGACAAGCACTTTCCCCCCTGG - Intergenic
1061550540 9:131331983-131332005 GACCCAGTCACTGTCCCCAGGGG + Intergenic
1062094287 9:134695018-134695040 AGGCGAGGCAGTGTCCCCCCTGG + Intronic
1062133149 9:134911059-134911081 GAACCTGGCTCTGTCTCCCCTGG - Intronic
1062284131 9:135765571-135765593 GAGCCAGCCCCTGCCCCGCCCGG - Intronic
1062699248 9:137890512-137890534 GAGCCAGGGCCCTTCCCCCCAGG + Intronic
1185599324 X:1328029-1328051 GAGCCAGGAACTAGCCCCACAGG - Intergenic
1190336429 X:49265543-49265565 GACCCAGCCACTGTCCCACTGGG + Intergenic
1190692111 X:52920625-52920647 GAGTCTCGCTCTGTCCCCCCAGG - Intergenic
1192195394 X:69024417-69024439 GAGAGAGGCACTGGGCCCCCGGG - Intergenic
1192200572 X:69063935-69063957 GAGCCAGGCTCTTGCCCCTCTGG - Intergenic
1197722788 X:129756258-129756280 GAGCCAGGCCCTGGTCCCCAGGG - Intronic
1198176204 X:134158255-134158277 GAGTGAGACACTGTCCCCCCCGG - Intergenic
1200957860 Y:8969989-8970011 GAGCCAGGCAGTGTCTCTTCAGG - Intergenic
1201372330 Y:13278898-13278920 GAGCCAGGCAGTGGTCACCCTGG + Intronic