ID: 1133337527

View in Genome Browser
Species Human (GRCh38)
Location 16:5015654-5015676
Sequence CCCCCTAAGAAGAAGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133337514_1133337527 26 Left 1133337514 16:5015605-5015627 CCACCTGCTCTCAAAAGCACTAG 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1133337527 16:5015654-5015676 CCCCCTAAGAAGAAGGAGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 270
1133337513_1133337527 30 Left 1133337513 16:5015601-5015623 CCAACCACCTGCTCTCAAAAGCA 0: 1
1: 0
2: 3
3: 23
4: 260
Right 1133337527 16:5015654-5015676 CCCCCTAAGAAGAAGGAGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 270
1133337515_1133337527 23 Left 1133337515 16:5015608-5015630 CCTGCTCTCAAAAGCACTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1133337527 16:5015654-5015676 CCCCCTAAGAAGAAGGAGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 270
1133337522_1133337527 -3 Left 1133337522 16:5015634-5015656 CCTCGAGGAGTACTGGGGTCCCC 0: 1
1: 0
2: 2
3: 9
4: 88
Right 1133337527 16:5015654-5015676 CCCCCTAAGAAGAAGGAGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133337527 Original CRISPR CCCCCTAAGAAGAAGGAGGA AGG Exonic
900414026 1:2526916-2526938 CCCCCTTAGAAGCAGGTGGGCGG - Intergenic
900712354 1:4122423-4122445 CCCTCTGAGACAAAGGAGGAGGG + Intergenic
904458129 1:30659265-30659287 CCCAGTAAGAGGCAGGAGGAGGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907973426 1:59407360-59407382 CCGCCTGAGAAAAGGGAGGAGGG + Intronic
908056286 1:60290699-60290721 CCCCCTCCGAAGTAGGAAGAAGG + Intergenic
908316617 1:62939199-62939221 CCCCCTAAAAAGAAGAGGCATGG - Intergenic
908798893 1:67858623-67858645 CTCACTAAGAGGAAGAAGGATGG - Intergenic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
910757977 1:90711157-90711179 GACCCCTAGAAGAAGGAGGAGGG + Intergenic
911421685 1:97650095-97650117 TCCCCTAAGTGGAGGGAGGAGGG - Intronic
911521015 1:98930908-98930930 CACCCTTTCAAGAAGGAGGAAGG + Intronic
911705028 1:101001107-101001129 CTCCCTAGGAAGATGCAGGATGG + Intronic
912271344 1:108212314-108212336 CCCCAAAATAAGCAGGAGGAAGG - Intergenic
912891888 1:113542110-113542132 TCCCCCAAGAATAAGGAGGGGGG - Intronic
916246893 1:162697025-162697047 CCCCCTACGCAGAATGAGAATGG - Intronic
918059888 1:181052001-181052023 CCCCCTTAGAGGATGGAGCATGG + Intronic
920659645 1:207904658-207904680 CCCACTGAGAAGCAGAAGGAAGG - Intronic
922054080 1:222023623-222023645 ATCCCTCAGAAAAAGGAGGAGGG + Intergenic
922194008 1:223344164-223344186 CCACCTAAGAAAACGGAGCAAGG + Intronic
923869310 1:237973698-237973720 GCCCCAAAGAACAAGGAGAAAGG - Intergenic
924150435 1:241124095-241124117 CCTCTTAAGAAGAACCAGGATGG + Intronic
1062888591 10:1038629-1038651 CCCCCTAAGGGGCAGGTGGAGGG + Intergenic
1064359403 10:14650051-14650073 CCAGATAGGAAGAAGGAGGAAGG + Intronic
1065378825 10:25068555-25068577 CACCCTAGGAGGAGGGAGGAAGG + Intergenic
1065968436 10:30786990-30787012 TCACCTAATAAGAAAGAGGAGGG + Intergenic
1068743591 10:60502682-60502704 CCCTGTAGGAAGAAGGAGGGAGG + Intronic
1070314034 10:75294365-75294387 CGCCCAAAGAAGAGGGCGGACGG + Intergenic
1070388126 10:75945447-75945469 CCACCCAAGAAGAAGCAGAAAGG + Intronic
1070763854 10:79045141-79045163 GGCCCTAAGCTGAAGGAGGAGGG + Intergenic
1072762289 10:98066678-98066700 CCCCCAAAGCAGAATGAGGGTGG - Intergenic
1074145101 10:110710638-110710660 CCCCCAAAGGGGAAGGGGGAGGG - Intronic
1074557212 10:114502444-114502466 CCCCCTACAAAGAAGGTGGGGGG - Intronic
1076172017 10:128327212-128327234 CCACCTGAGAATGAGGAGGAAGG - Intergenic
1076246347 10:128950283-128950305 GTCCTGAAGAAGAAGGAGGACGG + Intergenic
1076733215 10:132448433-132448455 CCGCCTAAGAAGGAGAAGGAGGG + Exonic
1077833397 11:5900807-5900829 CCCACTACGAGGAAGGTGGAAGG - Exonic
1077893761 11:6438466-6438488 CCTCCTGAAAAGAAGGAGAAAGG - Exonic
1078332959 11:10441028-10441050 CCCCTGAAGAAGGAGGAGGGTGG + Intronic
1078566658 11:12420553-12420575 CCACCTAATAATAAGGAGTATGG + Intronic
1081296667 11:41398546-41398568 CCCCTTTTGAAGAAGGAAGAGGG + Intronic
1081536174 11:43997879-43997901 CCCCCATAGAAGCTGGAGGAGGG - Intergenic
1083355420 11:62062677-62062699 TCCCCTAGGAAGAGGGAGGGAGG - Intergenic
1084072432 11:66745012-66745034 TCGCCTAAGGTGAAGGAGGAAGG + Intronic
1088715163 11:112542721-112542743 CCCACCAGGAAGAGGGAGGAAGG + Intergenic
1088939448 11:114438895-114438917 TCCCATAAGAAAAAGAAGGAAGG + Intronic
1089319800 11:117617852-117617874 CCCCCTACCAGGTAGGAGGAGGG + Intronic
1090273295 11:125402792-125402814 CCCCCTCTGAGGAAGGATGAAGG - Intronic
1090317424 11:125806191-125806213 CCCATTAAGAAGAAGTAGGTAGG - Intergenic
1091777304 12:3192789-3192811 CTCCCTGAGGAGGAGGAGGAGGG + Intronic
1091900632 12:4141282-4141304 CCCACCAGGAAGCAGGAGGATGG - Intergenic
1092993315 12:13924400-13924422 CCCCCAAAGAAGAAAGGTGAGGG + Intronic
1096078828 12:48820476-48820498 CCCCCTCTGAAGCAGTAGGAGGG + Intronic
1098051561 12:66459302-66459324 CACCCAAAGTAGAATGAGGATGG - Intronic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1100431618 12:94535997-94536019 CTCTCTAAGAGAAAGGAGGATGG + Intergenic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101994511 12:109515212-109515234 CCCCTTAAGAAGAAAGGGGATGG - Intronic
1103326786 12:120126832-120126854 CCTTCTAAGAATCAGGAGGAAGG + Intergenic
1105561433 13:21495832-21495854 TCTCCTAAAAAGAAGGAAGAAGG - Intronic
1106394081 13:29363487-29363509 CACTCTGAGAAGAAGGAGGTTGG - Intronic
1107631952 13:42351423-42351445 CCCCCTATGCAGAGGGAGAAGGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1111422077 13:88025218-88025240 CCACCTAAGAAGAAGGCTAAAGG - Intergenic
1112926416 13:104680263-104680285 CACCCCAGGAAGAAGGATGAAGG - Intergenic
1113347207 13:109491091-109491113 CACCCTATGAAGAAGTAGGGTGG - Intergenic
1113801571 13:113089273-113089295 GCCCCTCAGAAGCAGGAGGGTGG + Intronic
1113801585 13:113089343-113089365 GCCCCTCAGAAGCAGGAGGGTGG + Intronic
1113801600 13:113089413-113089435 GCCCCTCAGAAGCAGGAGGGTGG + Intronic
1114673324 14:24425441-24425463 CAGCCTAACAGGAAGGAGGAAGG - Intergenic
1114762575 14:25332165-25332187 CCCCCTTAGAAGAAACAGAATGG + Intergenic
1114902385 14:27079574-27079596 CCCACTTAGAAAAGGGAGGAAGG - Intergenic
1117315727 14:54568465-54568487 GCCCAAAAGAAGGAGGAGGAAGG - Intronic
1117338548 14:54775145-54775167 GCCCCAAGGAAGGAGGAGGATGG + Intronic
1117535996 14:56704028-56704050 CACCCTGAGTAGTAGGAGGATGG + Intronic
1117843707 14:59888676-59888698 CACCCAAAGAAGCAGGAGAAGGG + Intergenic
1119109206 14:71955898-71955920 CCCCATAAGAAAAAGGAAGATGG + Intronic
1119164441 14:72480594-72480616 CCCCCAGATAAGGAGGAGGAGGG + Intronic
1122409706 14:101519639-101519661 ACCCGTAAGAGGAAGGAGGGCGG + Intergenic
1123025627 14:105422354-105422376 CCCCCAGACAAGAAAGAGGAAGG + Intronic
1124336809 15:28863365-28863387 CCCGCTAAGGTGTAGGAGGAAGG + Intergenic
1125748109 15:42011110-42011132 TCCCCGAAGAACAAGGCGGAAGG - Intronic
1126498981 15:49323401-49323423 CCCCAAAAGAGGGAGGAGGAGGG + Intronic
1127546137 15:59995608-59995630 CCCCCCAAAAAGAAGGGGGTGGG - Intergenic
1128094487 15:64943659-64943681 CACCCTGAGAAGGAGGAGGGAGG - Intronic
1128370979 15:67039289-67039311 GCCCTTAAAAAGGAGGAGGAGGG - Intergenic
1129038589 15:72665611-72665633 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129211301 15:74071619-74071641 CTCCCGAAGGAGAAGGCGGACGG - Exonic
1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129402709 15:75293744-75293766 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129504501 15:76070257-76070279 CCAGTTAGGAAGAAGGAGGAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1132701384 16:1223591-1223613 CACCCTAAGTCGAAGGAGGAAGG + Exonic
1133294316 16:4743469-4743491 TCCCCCAGGAAGGAGGAGGAGGG - Intronic
1133337527 16:5015654-5015676 CCCCCTAAGAAGAAGGAGGAAGG + Exonic
1134066716 16:11233114-11233136 CCCCCCATGAAGAGGGAGGAGGG - Intergenic
1134798268 16:17061386-17061408 CCCTCTAAAAGGAAGGAGGCAGG + Intergenic
1135231443 16:20711859-20711881 ACCACTAGGAAGCAGGAGGATGG - Intronic
1136114849 16:28088014-28088036 CCCCCTTGGAAAAAGGAGAAGGG + Intergenic
1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG + Intergenic
1139337468 16:66243089-66243111 TCCTCTAAGAAGCTGGAGGATGG + Intergenic
1139339462 16:66258605-66258627 CACCCTTAGAAGAAGAAGGCAGG + Intergenic
1139461465 16:67126202-67126224 TCCCCTAAAAAGAGGGAAGATGG + Intronic
1140570378 16:76098646-76098668 CCCCCTAATATGAAGGAGTCAGG - Intergenic
1141993977 16:87625504-87625526 CCCCCTGAGCAGGAGGAGCAGGG + Intronic
1142739928 17:1925941-1925963 CCCTGTAGGAAGAAGGATGATGG + Intergenic
1142830132 17:2542670-2542692 CCCCCTGTGAAAAAGGAGAAGGG + Intergenic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1143265105 17:5630705-5630727 CCCCCAGGGAAGTAGGAGGAGGG + Intergenic
1144110164 17:12022712-12022734 CCCCCTGTGAAGATGGGGGAGGG + Intronic
1144425674 17:15139190-15139212 CCCCCAAACAAGAAGGAAGGAGG - Intergenic
1144837022 17:18161876-18161898 CCCCCTTAGAATATGGAGAAAGG + Intronic
1148972778 17:51498818-51498840 CCTCTTAATAAGAAGGAAGAGGG - Intergenic
1149457310 17:56798267-56798289 CCCCACAAGAAGAAGAAGGTAGG - Intronic
1151296981 17:73192997-73193019 CCCCCAACGAAGATGGCGGAGGG + Exonic
1151352302 17:73539024-73539046 CCCTCTAAGAGGAAGGGGGCAGG + Intronic
1151396160 17:73824403-73824425 CCTCCCAAGAAGCAGTAGGACGG - Intergenic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1153764711 18:8364623-8364645 CCCGCTGAGAAGAGGGTGGATGG - Intronic
1156239720 18:35241123-35241145 GCCCCTAGGAAGAGGGAGGTGGG + Intronic
1158696521 18:59708845-59708867 CCCTATAAGAAGAAGGAAGGTGG - Intergenic
1159133043 18:64302958-64302980 CATCCTAAGAAGAAGGATGGGGG + Intergenic
1159143192 18:64421915-64421937 CCCCTTTAGAAGGAGGAGGAGGG - Intergenic
1160057381 18:75496291-75496313 CAGCCTAAGAAGCAGGAAGATGG + Intergenic
1160412352 18:78683572-78683594 GCCCCGAAGAAGAAGAAGGGAGG + Intergenic
1162532839 19:11245761-11245783 CCCCCCAACAAGGAGAAGGAAGG + Intronic
1162548015 19:11342733-11342755 CCCCATGAGAAGCAGGGGGAGGG - Intronic
1163146143 19:15380222-15380244 CCCCCAGAGGAGGAGGAGGAGGG - Exonic
1164158049 19:22608271-22608293 CCCCAGAAGAAGGAGGAAGATGG - Intergenic
1164438088 19:28249802-28249824 TCACCCAAGAAGAAGGACGAAGG + Intergenic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1165280710 19:34794869-34794891 CCCCTTAAGATTAAGAAGGAGGG - Intergenic
1166288150 19:41845145-41845167 CCGGCTAAGAGGGAGGAGGACGG - Intronic
1167048998 19:47067485-47067507 CCCCCAACGGAGGAGGAGGAAGG - Exonic
1168292171 19:55362115-55362137 ACCCCTGAGTAGAGGGAGGAGGG - Intronic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
926285078 2:11482274-11482296 CCCCGTAAGAGGAGGGAGGACGG + Intergenic
927642650 2:24855195-24855217 CTTCCTAAGAAGAAGGGGGTGGG - Intronic
927667907 2:25044846-25044868 TCCCATAAGCAGAAGGAAGAAGG - Intronic
927925721 2:27012254-27012276 CCCCTTGAGAATTAGGAGGAGGG - Intronic
928099001 2:28423828-28423850 GTCCCTGAGAAGAAGGAGCACGG - Intergenic
928432162 2:31229177-31229199 CCCTCTAGAAAGAAGGAGAAGGG + Intronic
930024892 2:47023995-47024017 ACCCCAAAGAAGAAAGACGATGG - Intronic
932593436 2:73080374-73080396 CCCCCGGAGACCAAGGAGGAGGG - Intronic
933855226 2:86406871-86406893 ACCCCAAAAAAGCAGGAGGAAGG + Intergenic
933898644 2:86833652-86833674 CCCCCCAAGAAAAGGAAGGAAGG - Intronic
935559840 2:104548611-104548633 TCACCTAAGGAGAAGGAGGAAGG - Intergenic
937122484 2:119450586-119450608 TGCTCAAAGAAGAAGGAGGAAGG + Intronic
937217396 2:120321358-120321380 AACTCGAAGAAGAAGGAGGAGGG - Intergenic
939884723 2:147669045-147669067 ACCCCTTAGAGGAAGGAGGAAGG + Intergenic
940888449 2:159011923-159011945 GTCCCCAAGAAGAAGGAGGAGGG + Intronic
942594408 2:177579386-177579408 CCTCCTAAGAAGAACCATGATGG - Intergenic
943771434 2:191721848-191721870 CCCCCAGGGAAGAGGGAGGAAGG + Intergenic
944191621 2:197009985-197010007 CCCTTTAAAAAGAAGGAAGAAGG + Intronic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
944508810 2:200444445-200444467 CACCCTAAGAAAATGGAAGACGG + Intronic
946000493 2:216478113-216478135 TCCCATAAGAACAAGGAGGGTGG + Intronic
946238932 2:218342099-218342121 TCCCCTGAGAAGAGGCAGGAGGG - Exonic
947023391 2:225709430-225709452 CCCCAAAACAAGAAGTAGGATGG - Intergenic
1168847777 20:957158-957180 CCCCCCAAGAAGAAAGAACATGG + Intergenic
1168879831 20:1196897-1196919 TCCCTTAAGAAGAAGGAAGAAGG - Intergenic
1168900309 20:1358303-1358325 TCCCATGGGAAGAAGGAGGAGGG + Intronic
1169424507 20:5485606-5485628 CCCCCTTAGCTGATGGAGGAGGG - Intergenic
1171458056 20:25282983-25283005 CCCTCTCAGAAGAGGAAGGAGGG + Intronic
1173124051 20:40320463-40320485 CCCCCTAGGGAGAAGGAGATGGG + Intergenic
1174641530 20:52048719-52048741 CCCCCAAAAAGGAGGGAGGAGGG - Intergenic
1174869914 20:54173169-54173191 TCCCCTAGGAGGAAGGAGGCGGG - Intronic
1175461521 20:59155249-59155271 ACCTCTCAGAAGTAGGAGGAAGG + Intergenic
1176947838 21:15005363-15005385 CCCCCAAAGAAGAAAAAGGGGGG + Intronic
1177946794 21:27480437-27480459 ATCCCTAAGAAGAATGAGGGTGG + Intergenic
1178952666 21:36998058-36998080 CCTCATAAGAAAAAGGCGGAAGG - Intergenic
1179556629 21:42182771-42182793 GCCCCTAGGGAGAAGGAGGCTGG - Intergenic
1181021371 22:20105175-20105197 TTCTCTAAGAAGAGGGAGGAGGG + Intronic
1182868830 22:33628092-33628114 GCTCCCAAGAAGAAAGAGGAGGG + Intronic
1183516543 22:38270182-38270204 CCACCTATGAAGGAGAAGGAGGG - Intronic
1184314362 22:43672703-43672725 CACCCTCAGGAGAATGAGGATGG + Intronic
950680801 3:14583852-14583874 CCTCCCAAGATGGAGGAGGAGGG - Intergenic
952878512 3:37968355-37968377 CCCCAAAAGAAAAAGGGGGAAGG + Intronic
953214125 3:40901937-40901959 CCCCTAAACATGAAGGAGGAAGG - Intergenic
954035770 3:47850250-47850272 TCCCCAAAGAGGAAGGAGGAAGG + Intergenic
961075355 3:123977049-123977071 TTCCCTCAGAAGAAGGTGGAAGG - Intronic
961308333 3:125975473-125975495 TTCCCTCAGAAGAAGGGGGAAGG + Intronic
961814375 3:129541681-129541703 CCCCCCAAAAAAAAGGGGGAGGG - Intergenic
961905635 3:130260187-130260209 TGCCCTAGGAAGAAGAAGGAAGG + Intergenic
967430751 3:189382723-189382745 CCCCCTAAGAAGAAAGAATTCGG + Intergenic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
968076280 3:195817431-195817453 CCTGGTAAGAAGAAGGAGGCTGG - Intergenic
969121668 4:4915552-4915574 CCCCGCCAGATGAAGGAGGAGGG + Intergenic
969707358 4:8819143-8819165 CCCCCCAGTAAGAAGGCGGAGGG + Intergenic
969707371 4:8819175-8819197 CCCCCCAGTAAGAAGGCGGAGGG + Intergenic
971741701 4:30529737-30529759 CCCCCTAAAAAGAAAGAAGTGGG - Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
972311550 4:37888263-37888285 CACCCTAAGAATGATGAGGAGGG - Intergenic
972564585 4:40258672-40258694 CCCCCCAGGAAGAAAGGGGAGGG + Intergenic
975355247 4:73395059-73395081 CCCCCTGGGAAAAAGGAAGATGG + Intergenic
975392730 4:73837712-73837734 CCCAGTAAGAATAAGAAGGAAGG + Exonic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
977025456 4:91813246-91813268 CCCCCGAAAAAGAAGGAAAAGGG + Intergenic
977031013 4:91883193-91883215 TACCCCAACAAGAAGGAGGAGGG + Intergenic
984078284 4:175211078-175211100 CCCCAAAAGAAGAAAAAGGAGGG + Intergenic
986140292 5:5024032-5024054 CCCCCTATAATGAAGGAGAAAGG - Intergenic
986984677 5:13487144-13487166 CCCCCCAATATGATGGAGGAAGG + Intergenic
990972627 5:61525663-61525685 CCCCCTAAGCAGAAGGGTGAAGG - Intronic
990992204 5:61697405-61697427 CCCCCTAAGGAGAAGGAGGTTGG - Intronic
991985268 5:72278565-72278587 CTACCTATGAAGAAGCAGGATGG - Intronic
992233575 5:74685729-74685751 TCCCTTAAGAAGCAGTAGGAGGG - Intronic
992874811 5:81043523-81043545 CCCCCTAAGAAACATCAGGAAGG + Intronic
992952598 5:81875239-81875261 GCCCCTTAGAAGAAGCTGGAAGG + Intergenic
993739924 5:91525890-91525912 CCATCTGAGAAGAAGGAGAAGGG + Intergenic
993875967 5:93307155-93307177 TCCCCATAGAAAAAGGAGGAAGG - Intergenic
994195549 5:96918885-96918907 CGCCCTTAAAAGAAGGAGGTGGG - Exonic
994255377 5:97587249-97587271 CCTGCTAAGAAGGAGGCGGAAGG + Intergenic
997405548 5:133643844-133643866 CCCCATACGTACAAGGAGGAAGG + Intergenic
997527206 5:134561055-134561077 GCCCTTAAGAAGGAGGAGGAAGG + Intronic
997603593 5:135156953-135156975 CGCCCCAGGAAGAAGGTGGAGGG + Intronic
999837523 5:155390620-155390642 CCCCCTCAGAAGAACTGGGAAGG + Intergenic
1000201957 5:159020023-159020045 CCACCTAAGAATGAGGTGGATGG + Intronic
1000875015 5:166626528-166626550 CCCCCTAATATGAATGAAGAAGG - Intergenic
1001584056 5:172820787-172820809 CTCCCAAAGAAGGAGGATGAGGG + Intergenic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1001897824 5:175396744-175396766 CCCCCAAAGAAGAGGAAGGTTGG - Intergenic
1001981373 5:176040110-176040132 CCCCCAAAGAATGAAGAGGAAGG - Intergenic
1002236090 5:177803956-177803978 CCCCCAAAGAATGAAGAGGAAGG + Intergenic
1006659492 6:35628071-35628093 TCCCATAAGAATATGGAGGAAGG - Intronic
1006910156 6:37558429-37558451 CTCACTAAGAAGAGGGAGCATGG + Intergenic
1007787722 6:44290830-44290852 CCCCAGGAGAAGAAGGAGAAGGG - Intronic
1008387508 6:50909590-50909612 CCCCCAAAGAAGAAAAATGATGG - Intergenic
1009037770 6:58138729-58138751 CCACGTAAGGAGATGGAGGAGGG + Intergenic
1009213557 6:60892367-60892389 CCACGTAAGGAGATGGAGGAGGG + Intergenic
1009539122 6:64928184-64928206 CCCCATAAAAAGAAAGAGTAAGG + Intronic
1010081518 6:71869482-71869504 GGCCCTAATAAGAAGGGGGAGGG - Intergenic
1011599265 6:89044827-89044849 CCCTCTCAGAAGAAGCAGGGTGG - Intergenic
1014205446 6:118651317-118651339 CCGCCGAAGAAGCAGGAGGACGG - Intronic
1014455624 6:121631293-121631315 TCCCCTAAGAAGAAGGTAGCTGG + Intergenic
1015025396 6:128526163-128526185 CCCCCTCAGAAGTAGGTGGGAGG - Intergenic
1015928270 6:138331686-138331708 GCCCTTAAGCAGCAGGAGGATGG + Intronic
1017891379 6:158642555-158642577 CCCCCTAAAAAGAAAGGGCAGGG - Intronic
1021717787 7:23474642-23474664 CCCCCAAGGAAGAAAGAGGGAGG + Intergenic
1022216930 7:28272551-28272573 CTCCCCCAGAGGAAGGAGGAAGG - Intergenic
1023505984 7:40900038-40900060 CCCCCGAGGATGAAGGAGGTGGG - Intergenic
1023951183 7:44847678-44847700 CCGTCTTAGAAGGAGGAGGACGG - Intronic
1024355442 7:48409776-48409798 CATCCAAAGAAGAATGAGGAGGG + Intronic
1024896672 7:54268824-54268846 CCTACTAAGAAAAAGGAAGAAGG - Intergenic
1027955516 7:84874523-84874545 AGCCCAAAGAAGAAGGAAGATGG - Intergenic
1031476350 7:122227323-122227345 CCCCCTCAGATGAAGGGAGAGGG + Intergenic
1031994561 7:128221050-128221072 CTCACAAAGAAGGAGGAGGAGGG - Intergenic
1032851547 7:135799498-135799520 CACCCTAAGCAGAAGAAAGAAGG - Intergenic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1033614351 7:142998070-142998092 CTCCCTCAGAGAAAGGAGGAAGG + Intergenic
1034060898 7:148087995-148088017 TCCCCTAAGCAGAAAGAAGAGGG - Intronic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036005363 8:4656171-4656193 CCCCATAAGAACACTGAGGAAGG + Intronic
1036285584 8:7442114-7442136 CCCCTTTAGAGGAAGAAGGATGG + Intergenic
1036335889 8:7869415-7869437 CCCCTTTAGAGGAAGAAGGATGG - Intergenic
1040664519 8:49617502-49617524 CCACCTAAAAAGAATGAGGTAGG - Intergenic
1041299486 8:56395912-56395934 GCCTCTAAGAACAAGGAGAAAGG + Intergenic
1041448204 8:57976653-57976675 CCCCCTGAAAAGAAGAAGGAAGG - Intergenic
1042342342 8:67693674-67693696 CCACCTATGAACAAGGAGGTGGG + Intronic
1043326978 8:79064280-79064302 ACCCCTCAAAAGAAGGAGAAAGG + Intergenic
1044655293 8:94541969-94541991 CCAGCTAAGAAAAAGGAAGAGGG + Intronic
1046482989 8:114848014-114848036 GAACCTAAGATGAAGGAGGATGG + Intergenic
1046501415 8:115082816-115082838 CCCTTTAGGAAGACGGAGGAAGG + Intergenic
1046746770 8:117884285-117884307 CCCCCAAAGAAGAATGAAGGGGG + Intronic
1046817565 8:118601610-118601632 CCCCAAAAGAAGCAGGAAGAGGG - Intronic
1049345975 8:142138842-142138864 CCCCCTAGGACACAGGAGGAGGG + Intergenic
1051385401 9:16502557-16502579 CACCCCAAGAAGAAGTAAGAGGG - Intronic
1051410712 9:16786905-16786927 CCCACTAAGAAGTAGGAGAGGGG - Intronic
1052964505 9:34329580-34329602 CACCCGAAGCAGAAGGAGGTAGG - Exonic
1057241762 9:93417466-93417488 CCCACTAAGAAGAAGAAAAACGG - Intergenic
1057908251 9:98998980-98999002 ACCCCTGGGAAGAAGGAGGTGGG - Intronic
1058892237 9:109371039-109371061 ACCCCTGAGAGGAAGGAAGAGGG + Intergenic
1058930388 9:109713200-109713222 GCTCCCAAGAAGAAGGAAGAAGG - Intronic
1058969147 9:110064205-110064227 CTACCTAAGGAGGAGGAGGAAGG + Intronic
1059418539 9:114176762-114176784 AGCCCTGAGCAGAAGGAGGAGGG - Intronic
1061903012 9:133682556-133682578 CCCCCTCAGAACAAGGATGCTGG - Intronic
1062460502 9:136660790-136660812 CTCCCCAAGAAGAGGAAGGAAGG + Intronic
1203772083 EBV:54557-54579 CCGCCAAAGAAGGAGGAGGAGGG - Intergenic
1187402987 X:18978807-18978829 CCCATTAAGAAGGAGGATGAAGG - Intronic
1187414234 X:19078750-19078772 AACCCAAAGAAGAAGAAGGAAGG + Intronic
1187596874 X:20783030-20783052 ACACCTAAGAAGAAGGACAAAGG + Intergenic
1187743894 X:22387533-22387555 TCACCTAAGAAGAGGGAGGGAGG - Intergenic
1187859092 X:23664732-23664754 CTCCCTCAGCAGAAGGAGGCTGG + Intronic
1189118835 X:38371705-38371727 CCCCCTAAAGAGAAGGAAGGAGG + Intronic
1189504147 X:41594307-41594329 CTCCCGAACAAGAAGGAGAAGGG - Intronic
1189551626 X:42099423-42099445 TCCCCGGAGAAGAAGGAGAAAGG - Intergenic
1194910185 X:99631758-99631780 GCTCATAAGAAGAAGGAAGATGG - Intergenic
1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG + Intronic
1197720667 X:129742468-129742490 CCCTCTAGGAGGAGGGAGGAGGG + Intronic
1199616678 X:149661339-149661361 CCCCATACGAAGCAGGGGGATGG + Intergenic
1199625963 X:149741909-149741931 CCCCATACGAAGCAGGGGGATGG - Intergenic