ID: 1133338209

View in Genome Browser
Species Human (GRCh38)
Location 16:5020345-5020367
Sequence GTTTTGGGATGCAGCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133338209_1133338215 22 Left 1133338209 16:5020345-5020367 CCTGGAGAGCTGCATCCCAAAAC No data
Right 1133338215 16:5020390-5020412 GGTTGTGATGAACCCTGTCCAGG No data
1133338209_1133338216 23 Left 1133338209 16:5020345-5020367 CCTGGAGAGCTGCATCCCAAAAC No data
Right 1133338216 16:5020391-5020413 GTTGTGATGAACCCTGTCCAGGG No data
1133338209_1133338212 1 Left 1133338209 16:5020345-5020367 CCTGGAGAGCTGCATCCCAAAAC No data
Right 1133338212 16:5020369-5020391 GCCACAGTCCTGACGTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133338209 Original CRISPR GTTTTGGGATGCAGCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr