ID: 1133339437

View in Genome Browser
Species Human (GRCh38)
Location 16:5027160-5027182
Sequence GCCACCTGAAGCCACCCTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133339437_1133339440 14 Left 1133339437 16:5027160-5027182 CCCTCAGGGTGGCTTCAGGTGGC 0: 1
1: 0
2: 2
3: 18
4: 182
Right 1133339440 16:5027197-5027219 TACTGTAACATACCAGAGACAGG 0: 1
1: 0
2: 2
3: 13
4: 182
1133339437_1133339445 27 Left 1133339437 16:5027160-5027182 CCCTCAGGGTGGCTTCAGGTGGC 0: 1
1: 0
2: 2
3: 18
4: 182
Right 1133339445 16:5027210-5027232 CAGAGACAGGCTGAAGGGGCCGG 0: 1
1: 1
2: 1
3: 56
4: 561
1133339437_1133339442 22 Left 1133339437 16:5027160-5027182 CCCTCAGGGTGGCTTCAGGTGGC 0: 1
1: 0
2: 2
3: 18
4: 182
Right 1133339442 16:5027205-5027227 CATACCAGAGACAGGCTGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 208
1133339437_1133339443 23 Left 1133339437 16:5027160-5027182 CCCTCAGGGTGGCTTCAGGTGGC 0: 1
1: 0
2: 2
3: 18
4: 182
Right 1133339443 16:5027206-5027228 ATACCAGAGACAGGCTGAAGGGG 0: 1
1: 0
2: 2
3: 25
4: 224
1133339437_1133339441 21 Left 1133339437 16:5027160-5027182 CCCTCAGGGTGGCTTCAGGTGGC 0: 1
1: 0
2: 2
3: 18
4: 182
Right 1133339441 16:5027204-5027226 ACATACCAGAGACAGGCTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133339437 Original CRISPR GCCACCTGAAGCCACCCTGA GGG (reversed) Exonic
900097372 1:945422-945444 GCCACCTGTACCCATCCTGCAGG - Intronic
900532616 1:3162137-3162159 GCCACCTAATGCCACGCTCACGG - Intronic
901195871 1:7439473-7439495 GCCACCTGATGCCTCCATGGAGG + Intronic
902060174 1:13635210-13635232 GCTACCAGCACCCACCCTGATGG - Intergenic
904968466 1:34399752-34399774 GACCCCTCAGGCCACCCTGAAGG - Intergenic
906181539 1:43824321-43824343 GCCATCTGAAGTCAGCATGATGG - Intronic
906209411 1:44003792-44003814 GCCAGATGGAGCCACCCAGAGGG - Intronic
907909466 1:58814222-58814244 CCCAGCTCAAGCCACCCTGCAGG - Intergenic
908171896 1:61513136-61513158 GGCATCTGAAGCCAGCTTGAGGG + Intergenic
910509108 1:87983879-87983901 GCCACAGGAAGCCTCCCTGGTGG - Intergenic
910875614 1:91875224-91875246 GCCACATGAAGCCCCACTGGAGG + Intronic
912801254 1:112720909-112720931 GCCTCCCAAAGCTACCCTGAAGG - Intronic
917965790 1:180177726-180177748 GCCACCTGATGCCACCCTAAAGG + Intronic
919795252 1:201317793-201317815 GCCACCGAGAGCCAGCCTGAGGG + Intronic
920882241 1:209890848-209890870 GCCACCAAAATACACCCTGAAGG - Intergenic
921160346 1:212468011-212468033 GCTACCTGAAGCCACCCCTGTGG + Intergenic
921780485 1:219157197-219157219 GCCTCTTGATGACACCCTGAAGG + Intergenic
922158099 1:223055645-223055667 GTACCCTGAAGACACCCTGAAGG + Intergenic
922811953 1:228421269-228421291 GCCACCAGAAGGTACGCTGAGGG + Intergenic
923090334 1:230735711-230735733 GTCACCTGAGGCCAACCTAAGGG - Intergenic
1063137897 10:3233158-3233180 GGCACCTGGAGCCCCACTGATGG + Intergenic
1064634250 10:17347594-17347616 GGCACCTGAAGGCAGCCGGATGG - Intronic
1065615170 10:27513693-27513715 CCCACATGCAGCCAGCCTGATGG - Intronic
1067537822 10:47127546-47127568 GCTACCTGACACCACCCTGTGGG - Intergenic
1068702732 10:60037138-60037160 CCCAGCTGAAGCCACCATTATGG + Intronic
1069637396 10:69933579-69933601 GCAAGGTGAACCCACCCTGATGG - Intronic
1070813656 10:79310717-79310739 TCCCCCTGCAGCCTCCCTGATGG + Intronic
1071347181 10:84703908-84703930 GCCACCTGAATCAACCAAGATGG - Intergenic
1075123505 10:119681483-119681505 GCAACTAGAAGCCAGCCTGAAGG + Intergenic
1076479475 10:130775466-130775488 GCCACCCGAGGCCACCTTCATGG + Intergenic
1076932989 10:133546205-133546227 GCCACATGGAGCCACAGTGATGG - Intronic
1079731683 11:23942225-23942247 TCCACCTGCAGCCACCCGGGCGG - Intergenic
1081355882 11:42113042-42113064 GACTCCTTAAGCCATCCTGAAGG - Intergenic
1082091093 11:48090427-48090449 GTCTCCTGAAGCCACCCCTAAGG + Intronic
1083272972 11:61581247-61581269 GCCGCCCGAAGCCGCCCCGAGGG + Intergenic
1083581442 11:63827769-63827791 GCCACCTAGAGCAACCCTGAGGG + Intergenic
1085519132 11:77127991-77128013 GGCACCTGAAGCTAGCCTGGGGG + Intergenic
1090853247 11:130588894-130588916 GCCAGCTGGAGTAACCCTGATGG - Intergenic
1091046333 11:132328997-132329019 GCCCTGAGAAGCCACCCTGAAGG - Intronic
1092290198 12:7155822-7155844 CCTCCCTGAGGCCACCCTGATGG - Intronic
1093233133 12:16573717-16573739 GACCCCTGAAGCAGCCCTGAGGG + Intronic
1096464931 12:51843048-51843070 GCCACCTGCAGCCTCCCACATGG - Intergenic
1099601184 12:84740107-84740129 GCCACCTGAAGAAAGTCTGATGG + Intergenic
1101263791 12:103063597-103063619 GCCACCTGAGGCAACAGTGATGG + Intergenic
1103215758 12:119200125-119200147 ACCAGCTGACGCCACCCAGACGG - Intronic
1104111811 12:125711328-125711350 ACCCCCTGAGGCCACCCAGAAGG + Intergenic
1106506540 13:30375661-30375683 GACACCTGATGCCTTCCTGAAGG - Intergenic
1106717223 13:32403703-32403725 GCCACCTGAGGCAATTCTGATGG + Intronic
1108992641 13:56681402-56681424 GGAACCTGAAGCAACTCTGAAGG - Intergenic
1112321728 13:98414000-98414022 GCCAGCCAAAGCCACCATGAAGG - Intronic
1113103776 13:106750316-106750338 ACCAGCTGATGCCACCCAGATGG - Intergenic
1113855717 13:113444382-113444404 TCCCCCTAAAGCCACCCTGCTGG - Intronic
1113893615 13:113749314-113749336 GGCACCTGAGGCCAGCATGAGGG - Intergenic
1114193598 14:20458815-20458837 TCCACATGTAGCCACCCTCAGGG + Intronic
1114520555 14:23332016-23332038 GCCACCGCACTCCACCCTGAGGG - Intergenic
1116186835 14:41608482-41608504 GCCACCTGGAGCCACCTTGCCGG + Exonic
1117808726 14:59522466-59522488 GCCACCTTAAGCCAACCGCAAGG + Intronic
1118076787 14:62308251-62308273 GGCATCATAAGCCACCCTGAAGG - Intergenic
1119563172 14:75606901-75606923 GCCACCTCACTCCAGCCTGAGGG + Intronic
1122003256 14:98682211-98682233 GCCACATGAGTCCACCCTGCTGG - Intergenic
1124376957 15:29134504-29134526 CCCACCACAAGCCACCCTGAAGG + Intronic
1129447814 15:75631166-75631188 GCCACCTGGAGACACCTTGTAGG + Intergenic
1130104506 15:80919383-80919405 GCCACGTGCACCCACCCTGATGG - Intronic
1130821439 15:87500395-87500417 ACCACCTGAAGCCGCCCAGGGGG + Intergenic
1132319845 15:100918123-100918145 GCCACCTGGCGCCACCGCGAGGG - Intergenic
1132517586 16:373058-373080 GGAGACTGAAGCCACCCTGATGG - Intronic
1132574213 16:657227-657249 GCCCCCTGCAGCCACTCTGGGGG + Intronic
1132603082 16:782559-782581 TCCTCCTGGAGCCAGCCTGATGG + Intronic
1133110591 16:3545838-3545860 GGTCCCAGAAGCCACCCTGAGGG + Intronic
1133246499 16:4452343-4452365 CACACCTCAAGCTACCCTGATGG - Intronic
1133318547 16:4898963-4898985 CCAACCAGAAGCCACCCTGGGGG + Intronic
1133339437 16:5027160-5027182 GCCACCTGAAGCCACCCTGAGGG - Exonic
1134086657 16:11362063-11362085 TCATCCTGAAGCCACCCTGGTGG - Intronic
1140552603 16:75883141-75883163 GTCACCTGAAGACTCCCAGAAGG + Intergenic
1140772011 16:78213881-78213903 GCCTCCTGAAACCGCCCTGGGGG - Intronic
1142220081 16:88850000-88850022 GCTCCCTGAGGCCAGCCTGAGGG + Intronic
1143966166 17:10757779-10757801 GCCAGCTGAGGCCTCCTTGATGG - Intergenic
1146259908 17:31414555-31414577 GCCACCTGATGACACTCAGATGG + Intronic
1148347813 17:46915306-46915328 GCAACCTGAGGCCACCATGCTGG - Intergenic
1151958407 17:77392321-77392343 GCCACAGGAGGCCACTCTGATGG - Intronic
1152274967 17:79350779-79350801 GCCAGCTCACGCCACCCTGCAGG - Intronic
1154025535 18:10704353-10704375 GCCGCCTGAAGCCATCCACAGGG + Intronic
1155611194 18:27669456-27669478 GCCACCTGCTCCCACCATGAGGG - Intergenic
1157390942 18:47302908-47302930 CCTACCTTGAGCCACCCTGAGGG + Intergenic
1160534440 18:79584709-79584731 GCCACCTGAACCCACCACAAAGG - Intergenic
1161575582 19:5052653-5052675 GCCACCTGCAGCCAGACTGAGGG - Intronic
1162055471 19:8061072-8061094 ATCACCTGAACCCACCCTGGAGG - Intronic
1162201400 19:9023270-9023292 GACACCTGCAGTCACCCTGGGGG + Intergenic
1168086442 19:54050956-54050978 GCCACTTCACGCCACCCTGGGGG + Intronic
929271817 2:39981138-39981160 GCCATTTGCAGCCACCTTGAAGG - Intergenic
931707436 2:64958777-64958799 CCAAGCTGAAGCCACCCTGCAGG - Intergenic
931758330 2:65394345-65394367 GGCGCCAGCAGCCACCCTGATGG - Intronic
932049525 2:68384584-68384606 GCCACCTGACTCCCCCATGAAGG - Intronic
937299350 2:120829730-120829752 CCCTCCTGCAGCCACCCTGGTGG - Intronic
937626431 2:124049260-124049282 GCAACATGAAGCCTTCCTGATGG - Intronic
938289528 2:130141964-130141986 GCAAGCTGAAGCCACCGGGAGGG - Intronic
938467002 2:131530974-131530996 GCAAGCTGAAGCCACCGGGAGGG + Intronic
941395065 2:164964040-164964062 GCCACCTGAGGTCACTCTCATGG - Intergenic
945575403 2:211524325-211524347 TCCACCTGCAGCCCCCGTGAGGG - Intronic
947812065 2:233010932-233010954 GCCTCCTGAAGACACCATCATGG + Intronic
948301152 2:236908522-236908544 GCCATCTGGAGCCAACCTTAGGG - Intergenic
948607783 2:239146948-239146970 GTCAGCTGCAGCCACCCTGCAGG - Intronic
948896274 2:240929292-240929314 TCTACCTGAAGGCACCCTGGAGG + Intronic
1168883589 20:1226680-1226702 GCAACGTGAAGCCACCGGGATGG - Intronic
1174446474 20:50594470-50594492 GCCAGCTGTGGCCACCCTGAAGG + Intronic
1175217339 20:57398516-57398538 GCCACCACGAGACACCCTGAGGG - Intronic
1179497627 21:41783657-41783679 GCCACCAGAAGGAACCCTGAGGG + Intergenic
1179632836 21:42689147-42689169 GCCCACTGAAGCCTCACTGAGGG - Intronic
1179773894 21:43646920-43646942 GCTACCTAAAAGCACCCTGAAGG + Intronic
1180154894 21:45972964-45972986 GCCCCCAGAGCCCACCCTGAAGG - Intergenic
1181083230 22:20427492-20427514 GCTTCCTGGAGCCACCCTCAGGG - Exonic
1183028938 22:35087567-35087589 GCCACCTCCAGCCTCCCAGAGGG + Intergenic
1183057552 22:35316138-35316160 GCCTGCTGCAGCCACCCTGCCGG - Intronic
1183450430 22:37891554-37891576 GCCACGTGAAGACAGGCTGATGG + Intergenic
1183660128 22:39214958-39214980 GCCACCTGGAGTCACCGGGAAGG + Intergenic
1184030618 22:41892221-41892243 GCCATCTGATGTGACCCTGACGG + Intronic
1184115004 22:42417164-42417186 GCCACCTGAAGCCTGTGTGAGGG - Intronic
1184291938 22:43502057-43502079 GCCTCCTGGAGCCGCCCAGATGG - Intronic
1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG + Intergenic
1185242235 22:49752763-49752785 GCCACCTGATGGCAGCCTGTGGG + Intergenic
949661317 3:6282497-6282519 GGCAGCTGAAGCCTCCATGAAGG + Intergenic
950878214 3:16298141-16298163 GGCAGCTGAGGCCACACTGACGG - Intronic
951624517 3:24645070-24645092 CCCACCTGCCTCCACCCTGAGGG - Intergenic
952861113 3:37812917-37812939 GCCAGCTGAGCCCACCCTGAAGG - Intronic
953021160 3:39114278-39114300 GCCATGTGAGGTCACCCTGAAGG - Intronic
953805536 3:46064654-46064676 GACACATGAAGCCACCATGCTGG + Intergenic
954302538 3:49707583-49707605 GGCACCTGAAGAGACCCTCAGGG - Intronic
954444371 3:50539051-50539073 TCCTCCTGAAGCCTTCCTGAGGG + Intergenic
954708489 3:52493652-52493674 GCTCCCTGAAGCAACCCTCAGGG - Intergenic
958464581 3:94442461-94442483 GCCACCTGAAGTGTCCATGATGG - Intergenic
962677561 3:137768157-137768179 CCCACCTGAAGCAAACCTGAAGG + Intergenic
963966888 3:151381777-151381799 GCCCCCTTAAGCCAGCCTTAGGG + Intronic
964085275 3:152810056-152810078 GCCAACTGAAGCCTCCCTGAAGG + Intergenic
968813853 4:2811834-2811856 GCCATCTGAGGCCACACAGAGGG - Intronic
968918995 4:3512866-3512888 GCCAGCCCCAGCCACCCTGACGG + Exonic
970432413 4:16001099-16001121 GCCCCCTTAGGCCACCCTCATGG - Intronic
972034729 4:34506567-34506589 TCCACCTGAAGCCCCCGTGCCGG - Intergenic
973850291 4:54955150-54955172 GCCCCCTAGAGCCACCCAGAAGG + Intergenic
975610632 4:76199257-76199279 GCCACCCCATGGCACCCTGAGGG + Intronic
979183096 4:117755146-117755168 GACACCTGAAGCCTCCCTGCAGG - Intergenic
980276104 4:130652591-130652613 GTCTCCTGAATACACCCTGATGG - Intergenic
982578988 4:157154074-157154096 GCCTCAAGAAGCCTCCCTGAAGG - Intronic
983499859 4:168486908-168486930 GCCATCTGAAGTGACCCTGATGG + Intronic
984128489 4:175842591-175842613 CACACCTCCAGCCACCCTGAAGG + Intronic
985521571 5:376213-376235 TCCCCCTGAAGCCACCCAGGAGG - Intronic
985756698 5:1723610-1723632 CCAACCTGACGCCACCCAGAGGG - Intergenic
986662847 5:10074654-10074676 ACCACCTGCTGCCACCCCGAGGG - Intergenic
989839741 5:46047796-46047818 GCCACTTGAAACCACCCTTTTGG + Intergenic
990169173 5:53028842-53028864 CTCTCCTGATGCCACCCTGATGG + Intronic
991059168 5:62353853-62353875 ACCATCTGAAGGGACCCTGAGGG - Intronic
994507188 5:100657176-100657198 TCCACCTGCAGCCCCCCTGCAGG + Intergenic
997196645 5:131984890-131984912 GGCACCTTTAGCCACCCTCATGG + Intronic
997452146 5:133992417-133992439 GCATCCTGAAGCAACCATGAGGG - Intronic
998644614 5:144048399-144048421 GCCAACTGAAGCCACAGTAACGG - Intergenic
1002432636 5:179212327-179212349 GCCCACTGAACCCACCCTCAGGG - Intronic
1002432669 5:179212442-179212464 GCCCACTGAACCCACCCTCAGGG - Intronic
1002432710 5:179212589-179212611 GCCCACTGAACCCACCCTCAGGG - Intronic
1002574167 5:180162064-180162086 GGGACATGAGGCCACCCTGAAGG - Intronic
1002860284 6:1074061-1074083 GCCACCTGAACCAACTCTGCTGG + Intergenic
1005882381 6:30071308-30071330 GGCACCCGAACCCACCCTGCTGG - Exonic
1015978273 6:138813529-138813551 GCCATCTGGAGCCTCCCTTAAGG - Intronic
1019168315 6:170114321-170114343 GCATCCTGAGACCACCCTGAGGG - Intergenic
1019481725 7:1270094-1270116 GCCACCTGAATCATTCCTGATGG + Intergenic
1019860290 7:3652415-3652437 GCCACCGCATGCCACCATGAAGG - Intronic
1020002678 7:4764706-4764728 GCTGCCTGTGGCCACCCTGATGG + Exonic
1020673175 7:11145146-11145168 GCCACCTGAACCCCTCCCGAGGG - Intronic
1021838275 7:24702134-24702156 TTGCCCTGAAGCCACCCTGATGG - Intronic
1024134937 7:46397137-46397159 GACACGTGATGCCACCCTGCTGG + Intergenic
1028673576 7:93432800-93432822 GCCACCTGAAACAACCCAAAAGG + Intronic
1030682727 7:112450399-112450421 GCCACCTGACGTCACTCTGTGGG - Intronic
1030824683 7:114140788-114140810 GGCTCCTTTAGCCACCCTGAGGG + Intronic
1034980738 7:155474542-155474564 GCAGCCTGATGCCACCCTCAGGG + Intronic
1035373153 7:158391975-158391997 CCCTCCTGAAGCCACCCTGGGGG - Intronic
1035472575 7:159119718-159119740 CCCACCTGACCCCACCCTGGAGG - Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1036816512 8:11906598-11906620 GCCACCCGAGGCCACCCTCTTGG - Intergenic
1037962146 8:23105620-23105642 GCCATCTGCAGCCACCTGGATGG - Intronic
1037969306 8:23160788-23160810 GCCATCTGCAGCCACCTGGATGG + Intronic
1038044402 8:23753953-23753975 GCCTCCTGACCCAACCCTGATGG + Intergenic
1039428330 8:37505463-37505485 ACCACCTGAAGCCACACCAAGGG + Intergenic
1043382780 8:79721210-79721232 GCCACCTTAGGCCACCCTGTTGG + Intergenic
1045136031 8:99219399-99219421 GCCACTTGAAGCCAAGCTGCAGG - Intronic
1047188714 8:122658762-122658784 GACAACTGTAGCCACCCAGAAGG - Intergenic
1047652680 8:126940471-126940493 TACCCCTGAGGCCACCCTGAAGG + Intergenic
1047714981 8:127587176-127587198 GGCCCCTGAAGTCACACTGAAGG - Intergenic
1048738306 8:137526348-137526370 GCTACCTGAAGCCACCATGCTGG - Intergenic
1050629311 9:7541959-7541981 TCATCCTGAAGCCACACTGAAGG - Intergenic
1053132193 9:35622251-35622273 GCCACCTGATTGCACCATGAGGG + Intronic
1054880791 9:70142616-70142638 CTCACCAGAAACCACCCTGATGG - Intronic
1056340517 9:85626654-85626676 GACCCCTGTAGCCACTCTGAAGG - Intronic
1056565985 9:87772573-87772595 GGCACCTGAAACCATCCAGAGGG + Intergenic
1057279811 9:93701469-93701491 GTCACCTGGAGCCATCCTTAGGG + Intergenic
1059373538 9:113863172-113863194 GCCACGTGTAGCCACTCTGATGG - Intergenic
1059619709 9:115989929-115989951 GCCACGTGAAGACACACAGAAGG + Intergenic
1060817015 9:126640347-126640369 GTCACCTGAAGCCACTTGGAGGG - Intronic
1061792187 9:133064629-133064651 GCCACCTGCAGGGACCCTGAAGG + Exonic
1185690699 X:2153086-2153108 GCCCCCAAAAGCCACCCTCATGG + Intergenic
1191812718 X:65207323-65207345 GGCATTTGAAGCCACCCGGATGG + Intergenic
1192523836 X:71824549-71824571 CCCACCTGAAGCTACACAGAAGG + Intergenic
1193687156 X:84591726-84591748 GCCAACTGAACCCACAGTGATGG - Intergenic
1194717716 X:97306303-97306325 GCCCCCTGAAGCTACTCTGGGGG - Intronic
1195240023 X:102941988-102942010 GCCACCTGCTGCCTCCCTGAGGG - Intergenic
1195296776 X:103486382-103486404 GCCACCTGCTGCCTCCCTGAAGG - Intergenic