ID: 1133342525

View in Genome Browser
Species Human (GRCh38)
Location 16:5045897-5045919
Sequence GCCTTTCCTGGAACACCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133342525_1133342532 20 Left 1133342525 16:5045897-5045919 CCTGGAGGTGTTCCAGGAAAGGC 0: 1
1: 0
2: 5
3: 28
4: 191
Right 1133342532 16:5045940-5045962 TGGCTTCCGCTCCAGTCCCTAGG 0: 1
1: 0
2: 0
3: 14
4: 165
1133342525_1133342531 0 Left 1133342525 16:5045897-5045919 CCTGGAGGTGTTCCAGGAAAGGC 0: 1
1: 0
2: 5
3: 28
4: 191
Right 1133342531 16:5045920-5045942 CTTGGGCTCTGGAATTTCTGTGG 0: 1
1: 1
2: 0
3: 29
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133342525 Original CRISPR GCCTTTCCTGGAACACCTCC AGG (reversed) Intronic
902173896 1:14635055-14635077 GCCCTTCCTGCAACACCTGTGGG - Intronic
905365558 1:37449263-37449285 GCCTCTGCTGGAACTGCTCCTGG + Intergenic
905541365 1:38763041-38763063 GCCTTTCCTGGAACATGTCCTGG - Intergenic
910344934 1:86225647-86225669 ACCTTTTCTGAAACACTTCCTGG - Intergenic
911260249 1:95677393-95677415 GCCTTTCCTGCAACACCTTCTGG - Intergenic
915117872 1:153611813-153611835 CCCTCTCCAGGAACAGCTCCCGG + Intronic
915916035 1:159941638-159941660 GCTTTTCCTGGGACTCCACCAGG - Intronic
918075747 1:181170121-181170143 GCCTTCTGTGGAACTCCTCCAGG + Intergenic
920673538 1:208023282-208023304 GCCTCTCCTGGAGCAGCTGCTGG + Exonic
922515883 1:226208113-226208135 GCATCTCCTGGAAGACGTCCTGG - Intergenic
1063366882 10:5496433-5496455 GGCTTTCCTGGAGGACCTCCGGG + Intergenic
1067556839 10:47278676-47278698 GCCTTCCATGGACCTCCTCCAGG + Intergenic
1068192250 10:53667263-53667285 GCATGTCCAGGCACACCTCCAGG + Intergenic
1070956187 10:80465067-80465089 TGCTTGCCTGGAACACCTCTGGG + Intronic
1072104022 10:92256876-92256898 GCCTTTCCTAGAAGACCTCCAGG + Intronic
1073542263 10:104323855-104323877 ACCCTTCCTGGAACTCCTGCAGG + Intronic
1076675788 10:132147121-132147143 GCCTGCCGTGGAACACCTGCAGG - Intronic
1078329092 11:10404133-10404155 TCCTCTTCTGGAATACCTCCTGG - Intronic
1078777865 11:14410305-14410327 CCCTTTCCTCAAAGACCTCCAGG + Intergenic
1080107532 11:28526159-28526181 GCCTCTCCCGCCACACCTCCTGG + Intergenic
1080204381 11:29712629-29712651 GCCTTTCCCTCCACACCTCCCGG - Intergenic
1081612980 11:44574296-44574318 GCCTTTGCTCGCACACCTCAAGG + Intronic
1084051514 11:66603215-66603237 GCCTTTCCCTGAACTCCTGCTGG + Intronic
1084261293 11:67980466-67980488 GCTTTTGCTGGGACACCTCATGG - Intergenic
1086643539 11:89190227-89190249 GCGTTTTGTGGAACACCTCCTGG - Intronic
1088430595 11:109754159-109754181 GCCTCACCTGGAACACCTACAGG - Intergenic
1089176185 11:116550562-116550584 GTCTTTACTTGCACACCTCCAGG - Intergenic
1089280118 11:117368372-117368394 GCCTCTCATGGCTCACCTCCAGG - Intronic
1089794176 11:120967108-120967130 CCCCTTCCCGGCACACCTCCTGG - Intronic
1090208499 11:124898904-124898926 GGCCTTCCGGGAACAGCTCCAGG - Intergenic
1092332878 12:7601798-7601820 GCCTTTGGAGGAAGACCTCCTGG + Intergenic
1094305553 12:29015709-29015731 GCCTTACCTGGGAGACCTCCTGG + Intergenic
1099305942 12:80956081-80956103 GCCTTTCCTGTCATACTTCCTGG + Intronic
1101210815 12:102533750-102533772 GCATTTTCTGCAACTCCTCCAGG - Intergenic
1104848680 12:131860601-131860623 ACCTTCCCTGGAACACAGCCAGG + Intergenic
1105296245 13:19090000-19090022 GCCTTTCTTGGAACCCACCCCGG + Intergenic
1105745987 13:23377333-23377355 GCTTTTCCTGGACCACCTCTGGG + Intronic
1108685501 13:52815592-52815614 GCCTCTCCTTCCACACCTCCCGG + Intergenic
1112636991 13:101226666-101226688 GCCTTGCCTGGGAGACCTCCCGG + Intronic
1112990767 13:105511155-105511177 GCCTTTCCTGAAACAATTGCAGG - Intergenic
1114261351 14:21038873-21038895 ACCTTTCCTGGAACAGCTGTGGG - Intronic
1114412728 14:22516040-22516062 GCCTTGGCAGGAGCACCTCCTGG - Intergenic
1116594340 14:46820419-46820441 GCCTCTCCCGCTACACCTCCCGG - Intergenic
1118303652 14:64636584-64636606 GTCCTTCCAGAAACACCTCCAGG - Intergenic
1118611912 14:67547916-67547938 GCCTTTGCTGTTACACCTCTGGG + Intronic
1122156536 14:99753499-99753521 TCCCTTCCTGGAACACCTTGTGG + Intronic
1123017182 14:105381022-105381044 GCCTCTCCGTGAACACATCCAGG - Exonic
1125451105 15:39808366-39808388 GCCATTCCTGAAACACATCAGGG + Intronic
1126659410 15:51017401-51017423 GCGTTTGCTGGAACAGCTCAAGG + Intergenic
1127856596 15:62958692-62958714 GCCATCCCTGGATAACCTCCAGG + Intergenic
1129608683 15:77037080-77037102 CCCCTTCCAGGATCACCTCCAGG - Exonic
1129713973 15:77836339-77836361 CCCTCTCCTGGAAGCCCTCCAGG + Intergenic
1131296847 15:91156774-91156796 TCACTTCCTGGAAAACCTCCAGG + Intronic
1131397623 15:92099008-92099030 GGCTTCCCTGAAACATCTCCAGG + Intronic
1131466799 15:92662170-92662192 GCCCTGGCTGGGACACCTCCAGG + Intronic
1132205049 15:99980655-99980677 GCCCTTCCTGGCACTCCTGCAGG - Intronic
1132542022 16:514671-514693 GCCTTTCCTAGAACCTCTCCCGG - Intronic
1132556428 16:574761-574783 GCCTGTCCCGGGACACCTACCGG - Exonic
1132851716 16:2027651-2027673 GCCTTTACTGCGACCCCTCCTGG - Intronic
1133170797 16:3981399-3981421 GCCTTCCCTGGTCCACCCCCAGG - Intronic
1133342525 16:5045897-5045919 GCCTTTCCTGGAACACCTCCAGG - Intronic
1133450011 16:5896139-5896161 GCCTTTCCTGGGATCCATCCAGG - Intergenic
1136396230 16:29993963-29993985 GCCTTTCCTGGAGCTCTTCTTGG + Exonic
1136624787 16:31455716-31455738 GCCTTTCCTGGAGCAAATGCGGG - Intergenic
1138605861 16:58088356-58088378 GCCTTTCCTGGAACAAAGGCTGG + Intergenic
1141468095 16:84220351-84220373 GCCTTTCCTTGGAGTCCTCCAGG - Exonic
1141913792 16:87078842-87078864 GCCTTTCCAGCAACACCTCCAGG - Intergenic
1143547478 17:7606524-7606546 GGCTGTCCTGGAACACCTAGAGG + Intronic
1148464315 17:47855874-47855896 TCCTTTCCTGGCAGACCTCACGG - Intronic
1148757189 17:49979682-49979704 GCCCTTCCTGGTACAACTCATGG + Intergenic
1149571448 17:57675185-57675207 GGCTTTCCTGGCACACCCACAGG - Intronic
1150733714 17:67717700-67717722 TCCCTTCCTGGAGCACATCCGGG + Intergenic
1150922426 17:69497306-69497328 GACTTTCATGGAAGACTTCCTGG + Intronic
1151433408 17:74080044-74080066 GCCTTTGCTGGAACCCCTCAAGG + Intergenic
1152363319 17:79842266-79842288 GCCCTTCCTGGGAAACCTCCCGG + Intergenic
1152637719 17:81436962-81436984 GGGTTTCCTGGAGCATCTCCTGG + Intronic
1153232858 18:2956521-2956543 GCTTCTTCTGGAACACCTTCTGG + Intronic
1157103065 18:44747329-44747351 GTCCTTACTGTAACACCTCCTGG - Intronic
1157946603 18:51987686-51987708 TCTTTGCCTGGAACACATCCAGG - Intergenic
1161938203 19:7385232-7385254 ACCCTTCCTTGAACAGCTCCAGG + Intronic
1162209898 19:9083004-9083026 CCCTTTCCTGTAACACCTTGGGG + Intergenic
1163605868 19:18274967-18274989 TGCTGTCCTGGATCACCTCCTGG + Intergenic
1163862271 19:19748607-19748629 CCCCTTCCAGGAACCCCTCCCGG + Intergenic
1165811476 19:38614383-38614405 TCCTTACCTGGAGCACTTCCCGG + Exonic
1167359939 19:49024559-49024581 GCATTTCCGGGGACAGCTCCGGG - Intronic
1167364875 19:49049327-49049349 GCATTTCCGGGGACAGCTCCGGG - Intergenic
1167575932 19:50317381-50317403 GCCATTCCTGGAAGCCCCCCAGG + Intronic
926129223 2:10290450-10290472 GCTCTTCCTGGATCCCCTCCCGG + Intergenic
927785703 2:25973190-25973212 GTCTCTCCTTGAACACTTCCAGG + Intronic
931643549 2:64401829-64401851 GCCTATACTGGAACAACTACTGG + Intergenic
934752529 2:96802742-96802764 GCCTTTCCTGAAAGACTTTCTGG - Intronic
935340078 2:102051875-102051897 GTCTTTCCTGAGACACCACCAGG - Intergenic
937257587 2:120565989-120566011 GCCCTTACTGGGACATCTCCAGG - Intergenic
938221871 2:129575851-129575873 GTGTTTTCTGGAAGACCTCCTGG - Intergenic
938447459 2:131389785-131389807 CCCTCTCCTGCAACAGCTCCTGG - Intergenic
939196400 2:138978442-138978464 CCCTTGCCTGGATCACCACCTGG + Intergenic
940275656 2:151937906-151937928 GCTTTTGCTGGAACATCTGCAGG + Intronic
944210809 2:197205010-197205032 GCCTTTGCTGGAGCACATCAGGG - Intronic
944878652 2:203988627-203988649 GCCTGACCTGTAACACCCCCAGG - Intergenic
946690661 2:222306293-222306315 GCCTTTCCGGAAACACCGGCTGG + Intergenic
947536342 2:230942459-230942481 GCCCTTCCTGCAAAACGTCCTGG - Intronic
1168941266 20:1713115-1713137 GCCCTTTCTGGAACACGTCAGGG + Intergenic
1168965796 20:1897130-1897152 GCCTTTCCTGGGGCACCGGCTGG + Intronic
1170801089 20:19590917-19590939 ACCTTTCCTGGACCAACTGCTGG - Intronic
1173896489 20:46554900-46554922 GCCTGTCCAGGTCCACCTCCCGG - Intergenic
1174195528 20:48770223-48770245 TCATTTCCTGGTATACCTCCTGG - Intronic
1174418280 20:50382344-50382366 GCCATTCCTGGAACACCCGCTGG - Intergenic
1175311882 20:58018028-58018050 GCCTTGTCTGGGGCACCTCCTGG - Intergenic
1175939339 20:62530755-62530777 GCCTTCCCTCGAACCCCTTCAGG - Intergenic
1177330493 21:19654359-19654381 GGCTTTCCTGCACCAGCTCCTGG + Intergenic
1177630600 21:23722351-23722373 GCTTTTCCTGAACCTCCTCCAGG - Intergenic
1178112938 21:29387276-29387298 CCCTTTCCTGTAACACATTCAGG - Intronic
1179112589 21:38460238-38460260 GCCTTTCCTGGTTCACCTCCTGG - Intronic
1179612112 21:42559104-42559126 GCCCTTTCTGAAACTCCTCCTGG - Intronic
1180057333 21:45365636-45365658 GCCTCTCCTGGAGAAGCTCCGGG - Intergenic
1181323056 22:22023345-22023367 CCCTTTCCAGTAACACCTGCAGG - Intergenic
1182301736 22:29340807-29340829 GCCCCTACTGGAGCACCTCCTGG - Exonic
1182432373 22:30307368-30307390 GCCACTGCTGGAACTCCTCCAGG + Intronic
1183320692 22:37163536-37163558 GACTTTCCTGGAAGAGCTTCTGG - Intronic
1183353754 22:37347912-37347934 GCCTGTACTTGCACACCTCCAGG + Intergenic
1184245280 22:43232700-43232722 GCCTCTGCTTGCACACCTCCAGG + Intronic
1184607437 22:45582121-45582143 CCCTATCCTCGAACACTTCCTGG - Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
950098980 3:10345860-10345882 GCCTTTCCAGGAAGACCTCGGGG + Intronic
950722912 3:14897637-14897659 GCCTTTCCTCCAGCTCCTCCAGG - Exonic
952108351 3:30094054-30094076 GCCTTTCCTAGAAAATGTCCTGG + Intergenic
952316493 3:32237366-32237388 GCCTAGCCAGGAAGACCTCCAGG - Intergenic
952975368 3:38689931-38689953 CCCTCTTCTGGAATACCTCCTGG - Intergenic
953259468 3:41323613-41323635 GGGTTTCCTGGATCAGCTCCTGG - Intronic
955672565 3:61417356-61417378 GCCTTTGCTGGGACATCTCCGGG + Intergenic
956013064 3:64852203-64852225 GCCTAGCCTGGAACAGCACCTGG - Intergenic
957445187 3:80307691-80307713 GCCTTTCCTGGAGATCCTCCTGG - Intergenic
962159036 3:132979514-132979536 CCCTTTCCTGTAACAAATCCAGG + Intergenic
964222977 3:154367815-154367837 GCCTTTCCTGGAGATCCTCCTGG - Intronic
967556985 3:190871628-190871650 GCCTTTGATGGAACACTTTCAGG - Intronic
967668843 3:192207599-192207621 GCTTTTCCAGCAACACTTCCTGG - Intronic
968660112 4:1795361-1795383 GCCTCTCCTGGACCCCCTGCGGG + Intronic
969273775 4:6120868-6120890 GCATTTCTTGGCACACTTCCTGG + Intronic
969556781 4:7916889-7916911 GCATTTTCAGGAACAGCTCCCGG + Intronic
969665034 4:8552551-8552573 GCCTTTGCTTAGACACCTCCAGG + Intergenic
971189746 4:24416119-24416141 GCCTTTCTTGGATCACTTCCTGG - Intergenic
972933632 4:44104780-44104802 GCCTTTCCTGGGACCCAGCCTGG - Intergenic
975001193 4:69224620-69224642 GCCTTTCCTGGAGATCCTCCTGG + Intergenic
975004247 4:69267653-69267675 GCCTTTCCTGGAGATCCTCCTGG - Intergenic
975012661 4:69376623-69376645 GCCTTTCCTGGAGATCCTCCTGG - Intronic
976332746 4:83850929-83850951 GCTTTTCCTGGTAACCCTCCAGG - Intergenic
978025612 4:103869417-103869439 GTCTTTTCTGTAACAACTCCTGG + Intergenic
979184694 4:117773233-117773255 GGCATTTCTGGAACAGCTCCGGG + Intergenic
982217115 4:153092021-153092043 GCCTTGCCTGGCCCAGCTCCTGG + Intergenic
985034317 4:185822698-185822720 GCCTGTCCTGGAACACCCTGTGG - Intronic
985591286 5:766746-766768 GCCTTTCCTTGGCCACCTTCAGG - Exonic
985604344 5:850429-850451 GCCTTTCCTCGGCCACCTTCGGG - Exonic
987069803 5:14325562-14325584 CCCATGACTGGAACACCTCCCGG + Intronic
990247710 5:53879643-53879665 GCATTTCCTTGAACACCTAAAGG - Intergenic
991594359 5:68287946-68287968 GGCTTTCCTGTTACACCTGCAGG + Intronic
993440191 5:87947158-87947180 TCCTTTCATAGAACACCTCTAGG - Intergenic
995182407 5:109241184-109241206 GGCCTTCTTTGAACACCTCCCGG + Intergenic
995391653 5:111646557-111646579 GCCTTTCCTGAACCACATGCTGG - Intergenic
996978596 5:129461908-129461930 GCCTCCCATGGAACATCTCCAGG + Intronic
997421044 5:133766981-133767003 GCCTTTCCTTGACCATCTCCTGG - Intergenic
998280387 5:140801512-140801534 GCCTGTCCACGATCACCTCCAGG - Exonic
998282154 5:140822087-140822109 GCCTGTCCACGATCACCTCCAGG - Exonic
998282773 5:140828406-140828428 GCCTGTCCACGATCACCTCCAGG - Exonic
998283367 5:140834698-140834720 GCCTTTCCACGATCACCTCCAGG - Exonic
998284078 5:140841636-140841658 GCCTGTCCACGATCACCTCCAGG - Exonic
998285465 5:140856360-140856382 GCCTGTCCACGATCACCTCCAGG - Exonic
998286677 5:140869418-140869440 GCCTGTCCACGATCACCTCCAGG - Exonic
998287316 5:140875787-140875809 GCCTGTCCACGATCACCTCCAGG - Exonic
998287977 5:140882583-140882605 GCCTGTCCACGATCACCTCCAGG - Exonic
998300495 5:141014318-141014340 CCATTTCCTGGAAAAGCTCCAGG - Intergenic
999150608 5:149423840-149423862 GCGATTCCTGGCACACGTCCTGG + Intergenic
1001231990 5:169996730-169996752 GCCTTCCCTCGCACATCTCCAGG - Intronic
1001314649 5:170633583-170633605 AACATTCCTGGAACACATCCAGG - Intronic
1002294742 5:178224083-178224105 GCCTCTCCAGGATCAGCTCCTGG + Intronic
1004925501 6:20411806-20411828 TTCTTTCCTGTAACACCTCATGG + Intronic
1006555250 6:34860379-34860401 GTCTTTCCTGGAACACTTTGTGG + Intronic
1009624748 6:66125643-66125665 AACCTTCCTGGAACACCTCAGGG - Intergenic
1012019081 6:93893436-93893458 GCCTTTCCTATAATACCTCAGGG - Intergenic
1016107715 6:140183676-140183698 GCCTGTGCTTGAACACCTCCAGG + Intergenic
1016915127 6:149237683-149237705 ACCTCTCCTGGAACACCCCAGGG + Intronic
1019520958 7:1460241-1460263 GCCTTGCCTGGAACCCCCGCTGG - Intergenic
1020003123 7:4766805-4766827 GCCCTCCCTGGAGCACCCCCGGG + Exonic
1024048325 7:45600364-45600386 GCCTTTCCTGGAAGAGCCCGAGG + Intronic
1024246092 7:47471535-47471557 GCCTTTCCTGGAAGAGCCCTGGG + Intronic
1024564572 7:50670916-50670938 TACTTTCCTGGCACATCTCCAGG + Intronic
1025235003 7:57228436-57228458 GACATTCCTGGAACACCTGTTGG - Intergenic
1025252705 7:57362528-57362550 GTCATTCCTGGAACACCTGATGG + Intergenic
1026017493 7:66682524-66682546 GCCTGACCTGGATCACTTCCTGG + Intronic
1029452419 7:100648594-100648616 CCATCTCCTGGAACAGCTCCCGG + Exonic
1036956737 8:13195752-13195774 CCCTCTTCTTGAACACCTCCAGG - Intronic
1037300847 8:17450602-17450624 GCCTTTCTTGCAACCCCGCCAGG + Intergenic
1040423557 8:47261690-47261712 GCCTTTACTTGAAAACTTCCTGG + Intronic
1040806874 8:51405153-51405175 GCCTCTCCTTCCACACCTCCTGG + Intronic
1044848866 8:96408516-96408538 GCCTTTCCTGCCAGCCCTCCAGG + Intergenic
1045075286 8:98559438-98559460 GCCTTTCATGGGGCTCCTCCAGG - Intronic
1046084484 8:109415483-109415505 AGCTTTGCTGGAGCACCTCCAGG - Intronic
1046801454 8:118432977-118432999 GCCTTTGCTTCAACACCTCCAGG - Intronic
1047300030 8:123606126-123606148 GCCTCCCCTGCAACACCTGCGGG + Intergenic
1049232097 8:141489768-141489790 ACCTGTCCTGGGCCACCTCCTGG + Intergenic
1049372645 8:142275068-142275090 CCCTTCCCTGGGCCACCTCCAGG - Intronic
1049384013 8:142331784-142331806 ACATCTCCTGGAACAGCTCCTGG + Exonic
1049406478 8:142453831-142453853 CCCTTCCGTGGGACACCTCCTGG - Intronic
1049423229 8:142525963-142525985 GCTGTTCCTGGAGCACCCCCGGG - Intronic
1049687583 8:143945077-143945099 GCCTTTCCAAGAGCACCCCCTGG - Intronic
1051171059 9:14317719-14317741 GCCTTCCCTGGAAGAACTCTAGG + Intronic
1055102610 9:72480576-72480598 GCCTTTCCCTCCACACCTCCCGG + Intergenic
1056678312 9:88695498-88695520 GCCTTTCTGAGAACACGTCCAGG + Intergenic
1056683152 9:88737559-88737581 GCCTCTGCTGGAAATCCTCCAGG + Intergenic
1058147214 9:101425446-101425468 GCCTTACCAGGAACAGCTGCAGG + Exonic
1058306461 9:103447967-103447989 GCCTTCCCTGGAACATCTGGAGG - Intergenic
1059718963 9:116940355-116940377 GCCTTTTCTGCAATACCTCCTGG - Intronic
1061083063 9:128383688-128383710 GCCTCTCTTTGAACACCTCCAGG - Intronic
1061555694 9:131367230-131367252 GTCTTTCCTGGGAAAACTCCAGG + Intergenic
1061787931 9:133041983-133042005 GCCTTTCCTGGATCACCGTCAGG + Intronic
1062405799 9:136395647-136395669 GCTTCTCCTGGATGACCTCCTGG + Exonic
1191675368 X:63786845-63786867 AGCTTTCCAGGAATACCTCCAGG + Intergenic
1191900672 X:66038034-66038056 CCCTTTCCTGGAATGCCTCCTGG + Intronic
1193372925 X:80720243-80720265 CCTTTTTCTGGAATACCTCCAGG - Intronic
1193462984 X:81811782-81811804 GCCTTTCCTGGAGATCCTCCTGG + Intergenic
1195960046 X:110376919-110376941 GCCTTTCCTTGAGCACTTCATGG + Intronic
1195964974 X:110421830-110421852 GCTTTTCCTGTCACACCTCAAGG - Intronic
1198533966 X:137568798-137568820 CCCTTTCCGGGAAGACCGCCGGG + Intronic
1199423079 X:147669166-147669188 CCCTTTCCTGGAACACACCAGGG - Intergenic
1199856384 X:151762193-151762215 ACCATTCCTTGCACACCTCCAGG - Intergenic
1201750274 Y:17423796-17423818 GCCTTTCCTGGAGATCCTCCTGG + Intergenic