ID: 1133344405

View in Genome Browser
Species Human (GRCh38)
Location 16:5060338-5060360
Sequence AGTCCTGGGGCCCGAACGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133344394_1133344405 29 Left 1133344394 16:5060286-5060308 CCGGTTCCCAGCAGCTGCACCAG 0: 1
1: 0
2: 2
3: 46
4: 392
Right 1133344405 16:5060338-5060360 AGTCCTGGGGCCCGAACGTGGGG 0: 1
1: 0
2: 1
3: 5
4: 80
1133344398_1133344405 10 Left 1133344398 16:5060305-5060327 CCAGGCACACGTCACTTCTCTCC 0: 1
1: 0
2: 0
3: 12
4: 243
Right 1133344405 16:5060338-5060360 AGTCCTGGGGCCCGAACGTGGGG 0: 1
1: 0
2: 1
3: 5
4: 80
1133344393_1133344405 30 Left 1133344393 16:5060285-5060307 CCCGGTTCCCAGCAGCTGCACCA 0: 1
1: 0
2: 2
3: 36
4: 405
Right 1133344405 16:5060338-5060360 AGTCCTGGGGCCCGAACGTGGGG 0: 1
1: 0
2: 1
3: 5
4: 80
1133344396_1133344405 23 Left 1133344396 16:5060292-5060314 CCCAGCAGCTGCACCAGGCACAC 0: 1
1: 0
2: 4
3: 33
4: 300
Right 1133344405 16:5060338-5060360 AGTCCTGGGGCCCGAACGTGGGG 0: 1
1: 0
2: 1
3: 5
4: 80
1133344397_1133344405 22 Left 1133344397 16:5060293-5060315 CCAGCAGCTGCACCAGGCACACG 0: 1
1: 1
2: 2
3: 41
4: 337
Right 1133344405 16:5060338-5060360 AGTCCTGGGGCCCGAACGTGGGG 0: 1
1: 0
2: 1
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133344405 Original CRISPR AGTCCTGGGGCCCGAACGTG GGG Exonic