ID: 1133344424

View in Genome Browser
Species Human (GRCh38)
Location 16:5060411-5060433
Sequence TCCAGCTGACCCTCCAGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 453}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133344424_1133344432 10 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344432 16:5060444-5060466 AGAGGACAGATAGATGGGGTGGG 0: 1
1: 0
2: 1
3: 45
4: 354
1133344424_1133344429 5 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344429 16:5060439-5060461 GGCAGAGAGGACAGATAGATGGG 0: 1
1: 0
2: 4
3: 39
4: 423
1133344424_1133344431 9 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344431 16:5060443-5060465 GAGAGGACAGATAGATGGGGTGG 0: 1
1: 0
2: 2
3: 46
4: 500
1133344424_1133344433 11 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344433 16:5060445-5060467 GAGGACAGATAGATGGGGTGGGG 0: 1
1: 0
2: 2
3: 34
4: 438
1133344424_1133344430 6 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344430 16:5060440-5060462 GCAGAGAGGACAGATAGATGGGG 0: 1
1: 0
2: 3
3: 43
4: 494
1133344424_1133344436 18 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344436 16:5060452-5060474 GATAGATGGGGTGGGGTGTGGGG 0: 1
1: 0
2: 6
3: 97
4: 636
1133344424_1133344427 -8 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344427 16:5060426-5060448 CAGCTGGAACTCTGGCAGAGAGG 0: 1
1: 0
2: 5
3: 31
4: 297
1133344424_1133344435 17 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344435 16:5060451-5060473 AGATAGATGGGGTGGGGTGTGGG 0: 1
1: 0
2: 6
3: 57
4: 565
1133344424_1133344438 28 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344438 16:5060462-5060484 GTGGGGTGTGGGGGTGACCCAGG 0: 1
1: 1
2: 3
3: 70
4: 628
1133344424_1133344428 4 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344428 16:5060438-5060460 TGGCAGAGAGGACAGATAGATGG 0: 1
1: 0
2: 5
3: 76
4: 644
1133344424_1133344437 19 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344437 16:5060453-5060475 ATAGATGGGGTGGGGTGTGGGGG 0: 1
1: 0
2: 21
3: 174
4: 1387
1133344424_1133344434 16 Left 1133344424 16:5060411-5060433 CCCGGGCTGGAGGGTCAGCTGGA 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1133344434 16:5060450-5060472 CAGATAGATGGGGTGGGGTGTGG 0: 1
1: 0
2: 11
3: 100
4: 759

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133344424 Original CRISPR TCCAGCTGACCCTCCAGCCC GGG (reversed) Exonic
900240613 1:1615728-1615750 TCCCGCTGGCCCAGCAGCCCCGG + Intronic
900395700 1:2452432-2452454 TCCTGCTCTCCCTCCTGCCCTGG + Intronic
900470435 1:2851602-2851624 TCCCCCTTACCCTCCACCCCAGG + Intergenic
900880032 1:5374243-5374265 TCCAGCTGAGCTTAAAGCCCAGG - Intergenic
901667049 1:10831942-10831964 GCCATCTGACCCTCCACCCCAGG + Intergenic
901790834 1:11653167-11653189 TCCAGCCCTCCCTCCGGCCCTGG + Intronic
902472485 1:16658379-16658401 TCCTGCTGCCCATCCTGCCCGGG - Intergenic
902486319 1:16749067-16749089 TCCTGCTGCCCATCCTGCCCGGG + Intronic
902530799 1:17089517-17089539 TCCACCTGCCCCACCACCCCTGG - Intronic
902560859 1:17276733-17276755 TTCAGCTGAGCCTCCTGCCTTGG - Intronic
902916158 1:19640883-19640905 TCCAGCTGCCCCTACAGGCCTGG - Intronic
903265805 1:22157222-22157244 TCCAGCTGTGCCTCCAGACTGGG - Intergenic
903853503 1:26321940-26321962 TTCCCCTCACCCTCCAGCCCTGG - Exonic
903964676 1:27079685-27079707 TTCAGATGACACCCCAGCCCTGG + Intergenic
904032935 1:27544405-27544427 TCCAGTTCAGCCTCCACCCCAGG - Intronic
904049724 1:27631911-27631933 GCTCCCTGACCCTCCAGCCCTGG - Intronic
904251510 1:29227966-29227988 TCCAGGTGACTCTGCTGCCCAGG - Intronic
904315572 1:29658081-29658103 TCTAGCTGACCCACAAGTCCAGG - Intergenic
904833609 1:33320937-33320959 ACCAGCTGAGCCTCCAGTCCTGG - Intronic
905131034 1:35757789-35757811 GCCACCTGAACCTCCAGCCCTGG + Intronic
905912770 1:41665027-41665049 CCCAGCTGACACTCCTGGCCTGG - Intronic
906480267 1:46194865-46194887 CCCATGTGTCCCTCCAGCCCAGG + Exonic
906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG + Intronic
907301218 1:53487422-53487444 TCCGCTTGACCCTCCAACCCTGG - Intergenic
907427128 1:54386969-54386991 TCCCCCTGACCCTCCACACCGGG + Intronic
908703821 1:66930019-66930041 TCCAGCTGATCCGCCACTCCAGG - Intronic
909145257 1:71922172-71922194 TCCAGCTGAACCTGGAGCCAAGG + Intronic
909994163 1:82258705-82258727 TCCAGGTGATCCTCCCGCCTTGG - Intergenic
911665536 1:100547180-100547202 TCCAGCTGACTCAAAAGCCCAGG + Intergenic
912932678 1:113979252-113979274 TCCAGAGGACCCTACAGCCTAGG + Intergenic
913195640 1:116454209-116454231 TCCTGCTGACCTCTCAGCCCAGG + Intergenic
914846480 1:151286581-151286603 TCCTGCTGAGCCTCCAGCCAGGG - Exonic
915286351 1:154855793-154855815 TCCAGCTGAGTAGCCAGCCCAGG - Intronic
915338950 1:155166038-155166060 TCCACCTGACCCTTCACCCGAGG + Intergenic
918306119 1:183248489-183248511 TCCAGCTGAATCCTCAGCCCTGG + Exonic
919866632 1:201787857-201787879 TCCATCTGACCTTCAAGCCGGGG + Intronic
919878868 1:201889254-201889276 TGAAGCTGACCCTGCACCCCGGG - Intronic
920045280 1:203128645-203128667 TCCGGGTGCCCCTCCAGCCTGGG + Intronic
920074552 1:203326963-203326985 ACCAGCTGACCTTGCAGGCCCGG - Intergenic
920129865 1:203723812-203723834 GGCAGCTGGCCCTCCAGCCAAGG - Intronic
921314411 1:213876675-213876697 TCCAGCTCACCCCCAAACCCAGG + Intergenic
921583676 1:216924452-216924474 TCCAGCAGCCCCTTCAGCCAGGG + Intronic
922468676 1:225862110-225862132 TACTGCTGACCCACCATCCCTGG - Intronic
922514862 1:226199781-226199803 TCTAGCAGTGCCTCCAGCCCTGG + Intergenic
922712733 1:227845503-227845525 TCCCGCTGATCCTGGAGCCCTGG + Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924290526 1:242531679-242531701 CCCAGCTCACCCTTCAGCCCAGG - Intergenic
924675648 1:246174678-246174700 TTCAGGTGACCCTCCCGCCTTGG + Intronic
1062813230 10:481022-481044 TCCCCGGGACCCTCCAGCCCAGG + Intronic
1064052435 10:12069770-12069792 TCAAGCTGATCCTGCAGCCTCGG + Intronic
1064230314 10:13524350-13524372 TCCAGCTGACCAACCAGGCACGG + Intronic
1064776314 10:18781681-18781703 TCCAGCAGACCCTCCAAGTCTGG - Intergenic
1065792428 10:29273501-29273523 TCCAGATGACAACCCAGCCCAGG - Intergenic
1066578318 10:36851284-36851306 TTCAAGTGACCCTCCAGCCTTGG - Intergenic
1067751473 10:48974638-48974660 CCCAGCAGAGCCTCCACCCCTGG + Intronic
1067982935 10:51107601-51107623 TCCTGGTGACCCTCCTGCCTTGG - Intronic
1068557684 10:58477366-58477388 TCCAGCAGAACCTCCAGCTCAGG + Intergenic
1069534362 10:69241962-69241984 TCCAGCTGACCCCCTCGCTCTGG - Intronic
1069718417 10:70535099-70535121 TCCAGGGGCCCCTGCAGCCCTGG - Intronic
1069918597 10:71802422-71802444 CCTGGCTGACCCCCCAGCCCAGG - Intronic
1070948652 10:80413417-80413439 GCCAGCTGACTTTCCAGGCCTGG + Intronic
1071293677 10:84204324-84204346 TCAGGCTATCCCTCCAGCCCTGG + Intronic
1073051118 10:100668084-100668106 TCCACATGACCCCCCAGCCCAGG + Intergenic
1074386490 10:113020492-113020514 CCCATCTGGTCCTCCAGCCCTGG - Intronic
1075392743 10:122104602-122104624 TCCAACTGATCCTCCTGCCTTGG + Intronic
1075717757 10:124566788-124566810 CCCAAATGGCCCTCCAGCCCTGG - Intronic
1075885957 10:125899291-125899313 TTCAGGTGATCCTCCCGCCCTGG + Intronic
1077058569 11:607818-607840 TCCAGCCAGCTCTCCAGCCCTGG + Exonic
1077067429 11:648547-648569 TCCAGCCGGACCTCCAGCCCAGG - Intronic
1077113524 11:872592-872614 TCCAGAAGCCCCTCCAGACCAGG + Intronic
1077251952 11:1564660-1564682 GCCAGCTGAGCCGCCAACCCTGG + Intronic
1078548110 11:12261022-12261044 CCCAGCGGATCCCCCAGCCCGGG + Intronic
1078849259 11:15149239-15149261 TACAGCTGTCACTCCAGGCCAGG + Intronic
1079133373 11:17762346-17762368 TCCGGTGGACCCTCCCGCCCTGG - Intronic
1080258538 11:30321000-30321022 TCCACCTGGCCCTCTAGCCCAGG + Intergenic
1080590870 11:33722281-33722303 CCCAGCTGCTCCTCCAGGCCTGG - Intronic
1080601940 11:33829215-33829237 TCGCGGTGACCCTGCAGCCCAGG + Intergenic
1081545221 11:44066678-44066700 TCCAGCTCTCCCGACAGCCCAGG - Exonic
1081576037 11:44319141-44319163 TCAGGTTGACCCTCCAGCCCAGG + Intergenic
1082809027 11:57467549-57467571 CCCAGCTGGCACTCCTGCCCTGG + Intronic
1083856296 11:65394613-65394635 TTCACCTGAGGCTCCAGCCCAGG - Intronic
1083943323 11:65910423-65910445 ACCAGCCACCCCTCCAGCCCAGG + Intergenic
1084091765 11:66883362-66883384 TCCTGCCGACCCTGCAGCACGGG + Intronic
1084189695 11:67493343-67493365 TCCCCCTTACCCTCCACCCCCGG - Intronic
1084742108 11:71146588-71146610 TCCTCCTGTCCCTCCAGCCCTGG - Intronic
1085123792 11:73983609-73983631 GCCAGCTGCCTGTCCAGCCCTGG + Intergenic
1085304154 11:75475796-75475818 CCCTGCTGCCCCTCCAGCCTTGG + Intronic
1085695935 11:78704848-78704870 TCCATCTGTCCCTGCAGCTCAGG + Intronic
1086296998 11:85380423-85380445 TCCAGGTGATCCTCCTGCCTTGG - Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1088583444 11:111336649-111336671 TCTTGCAGATCCTCCAGCCCAGG - Intergenic
1088647243 11:111926994-111927016 TCCAGCTCCGCCTCCAGCCGCGG - Intergenic
1089401327 11:118166296-118166318 TCCAGCTTTGCCTGCAGCCCTGG + Exonic
1089912976 11:122121993-122122015 TCCATCTCTCCCTCCAGCTCTGG - Intergenic
1090129388 11:124123769-124123791 TACAGGGGACCCTCCATCCCAGG + Exonic
1090454310 11:126834766-126834788 TGCAGCTGGCCCTGCGGCCCTGG + Intronic
1092385283 12:8032371-8032393 TCCAGCTGACACCCCAACTCCGG - Intergenic
1092525293 12:9306091-9306113 TCCTGCAGAGCCTGCAGCCCAGG + Intergenic
1092541979 12:9425726-9425748 TCCTGCAGAGCCTGCAGCCCAGG - Intergenic
1094022213 12:25926393-25926415 CCCAGCTGATCCTCCTGCCTTGG - Intergenic
1094511031 12:31096713-31096735 TCCTGCAGAGCCTGCAGCCCAGG + Exonic
1094701155 12:32872056-32872078 TCTTCCTGATCCTCCAGCCCAGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095510307 12:42944085-42944107 CGCAGCTGTCCCTCCACCCCAGG + Intergenic
1095945341 12:47750420-47750442 TCCTCCTGTCCCTGCAGCCCAGG - Exonic
1096152855 12:49325523-49325545 TGTGGCTGACCCTGCAGCCCTGG + Exonic
1096501100 12:52064212-52064234 GCCTGCTGACCCTCCAGCCTGGG - Intergenic
1096514031 12:52146648-52146670 TTCAGCTGATACTCCATCCCTGG - Intergenic
1097918253 12:65042645-65042667 CCCCTCTGCCCCTCCAGCCCCGG + Intergenic
1098326892 12:69312514-69312536 TATAGCTGACCCTACAGCCTAGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098586989 12:72165714-72165736 TGCCCCTGACCCTCCAGCCTGGG - Intronic
1100915059 12:99411046-99411068 TCCACCTGCTCCTCCAACCCAGG - Intronic
1101789289 12:107912827-107912849 TGCAGCTGGCCCTCCCGCACTGG + Intergenic
1101931199 12:109015576-109015598 TCCAAGTGACCCTCCCGCCTTGG - Intronic
1101961754 12:109256096-109256118 GCCACCTGGCCCTCCAGCCTGGG + Intronic
1102473691 12:113175022-113175044 CCCAGCTCACGCACCAGCCCGGG + Exonic
1102848624 12:116216242-116216264 TTCAACTGATCCTCCAGCCTTGG + Intronic
1102953151 12:117043295-117043317 TCCTGCTCCCCCACCAGCCCAGG - Intronic
1103607743 12:122099525-122099547 ACCTGCTGTCCCTGCAGCCCGGG + Intronic
1103958567 12:124593358-124593380 CCCAGCTGAGCCTGCACCCCCGG + Intergenic
1104398351 12:128454682-128454704 TCCAGCTCAGCATCCAGCCAAGG - Intronic
1104756661 12:131273721-131273743 CCCAGCCCACCCTCCATCCCGGG - Intergenic
1106107394 13:26744875-26744897 GCCAGCTCACCCACCAGTCCTGG + Intergenic
1106788122 13:33127504-33127526 TCCAGCTGTCGCACCAGCCCCGG - Exonic
1108532585 13:51341481-51341503 TCCAGCTCACCCTGCTGCTCAGG + Intronic
1110436164 13:75480990-75481012 GCCAGCTCCCCCTCCATCCCGGG + Intronic
1112395238 13:99023991-99024013 TCCAACTGACCCCTCAGCTCAGG + Intronic
1113387193 13:109859612-109859634 TCCAGCTGCCCCTGCAGCTCAGG - Intergenic
1113513300 13:110872571-110872593 TCAAGGTGACCTTCCAGCACAGG + Intergenic
1114629450 14:24149789-24149811 TTCAGCTGACCCTTCAGACTAGG - Intronic
1114646910 14:24261001-24261023 TGGATCTGCCCCTCCAGCCCAGG - Intronic
1115731695 14:36276198-36276220 ACCAACTGACTCTCCAACCCTGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118745132 14:68767957-68767979 TGCAGCAAAGCCTCCAGCCCTGG - Intergenic
1121040547 14:90742956-90742978 TCCAGCTGACTACACAGCCCTGG - Intronic
1121308047 14:92919250-92919272 TCAGGCTGACCCTAGAGCCCCGG + Intergenic
1121309004 14:92924681-92924703 CCCAGCAGGCTCTCCAGCCCTGG + Intronic
1122596855 14:102899695-102899717 TCCAGTAGACCCTAAAGCCCTGG + Intronic
1123193455 14:106593198-106593220 CCCAGCTGACCCTGCAGCTCTGG - Intergenic
1123199006 14:106643657-106643679 CCCAGCTGACCCTGCAGCTCTGG - Intergenic
1202872118 14_GL000225v1_random:174664-174686 TTCAGGTGATCCTCCTGCCCTGG - Intergenic
1123872168 15:24587636-24587658 TCCAGCTGATCCTTCAGCTCAGG + Intergenic
1124283963 15:28385801-28385823 TCCAGCGGTAGCTCCAGCCCGGG + Intronic
1124642371 15:31403891-31403913 TGCAGCTGGCGCTCCAGTCCGGG - Intronic
1124849728 15:33324725-33324747 ATCTGCTGCCCCTCCAGCCCAGG + Intronic
1125504176 15:40257442-40257464 CCCACCTGACCCTCCAGACCTGG - Intronic
1126852253 15:52804565-52804587 CCCAGCTGACCCTCCTGCCCCGG - Intergenic
1127882424 15:63170040-63170062 CCCAGCTGCCCTTCCTGCCCTGG - Intergenic
1128199649 15:65793383-65793405 TCAAGCTGACCCTCTTGCCTCGG - Intronic
1129182662 15:73886944-73886966 CCCAGCTGTCCCCCCAACCCTGG + Intronic
1129516715 15:76161636-76161658 TCCATCTGAGCCTCAGGCCCAGG - Intronic
1130195806 15:81779322-81779344 CTCAACTGATCCTCCAGCCCTGG + Intergenic
1130259595 15:82344859-82344881 TCCAGCAGCCTCTCCTGCCCTGG + Exonic
1130269087 15:82434327-82434349 TCCAGCAGCCTCTCCTGCCCTGG - Exonic
1130281638 15:82524150-82524172 TCCAGCAGCCTCTCCTGCCCTGG - Intergenic
1130385051 15:83403747-83403769 TCCAGCCTGCACTCCAGCCCGGG + Intergenic
1130473008 15:84240312-84240334 TCCAGCAGCCTCTCCTGCCCTGG - Exonic
1130480422 15:84354377-84354399 TCCAGCAGCCTCTCCTGCCCTGG - Intergenic
1130491289 15:84433382-84433404 TCCAGCAGCCTCTCCTGCCCTGG + Intergenic
1130502872 15:84512182-84512204 TCCAGCAGCCTCTCCTGCCCTGG + Intergenic
1130595306 15:85244990-85245012 TCCAGCAGCCTCTCCTGCCCTGG - Intergenic
1131422228 15:92316767-92316789 TCCTTCTGACCCTCCAGGTCGGG - Intergenic
1131429995 15:92379385-92379407 TTCAGATGAGACTCCAGCCCAGG - Intergenic
1131438175 15:92439487-92439509 TCCAGCCGGCTCCCCAGCCCTGG + Intronic
1132464645 16:72053-72075 CCGAGCTGAAACTCCAGCCCAGG - Intronic
1132481255 16:167247-167269 TCCCTGTGACCCTGCAGCCCTGG + Intergenic
1132553840 16:564252-564274 TCCAGCTCCCCCTCCTGCCCTGG - Exonic
1132606781 16:796976-796998 CCCAGCAGACCCTCGAGCCCTGG - Exonic
1132636094 16:947485-947507 CCCAGCGTCCCCTCCAGCCCTGG + Intronic
1132659495 16:1055065-1055087 CCCAGCTGACCTTCCTGGCCTGG - Intergenic
1132731369 16:1363861-1363883 CCCAGCTGTCCCCCCACCCCTGG + Exonic
1132794286 16:1711538-1711560 AACAGCTCATCCTCCAGCCCTGG - Intronic
1133216232 16:4294151-4294173 TACAGCTGGCCCTCCAGCCTCGG + Intergenic
1133344424 16:5060411-5060433 TCCAGCTGACCCTCCAGCCCGGG - Exonic
1134042794 16:11081171-11081193 TCCCTCTGACCTTGCAGCCCCGG + Intronic
1134103589 16:11469942-11469964 TGCCGCTGACACTCCAGCCTGGG - Intronic
1134276456 16:12780667-12780689 TCCAGCTGTACCTGCAACCCAGG + Intronic
1135253031 16:20916982-20917004 CTCAACTGACCCTCCAGCCTTGG - Intronic
1136022513 16:27449057-27449079 TCCAGGTGACCGGCCACCCCAGG - Exonic
1136281163 16:29212285-29212307 TCCTGCCCACTCTCCAGCCCAGG - Intergenic
1136626829 16:31466614-31466636 TCCAGCTCCTCCTCCAGCCCAGG - Exonic
1137561149 16:49503205-49503227 TCCAGCAGCCCCACCTGCCCAGG + Intronic
1139365024 16:66427628-66427650 TCCCGCGGACCCTCGACCCCGGG + Intronic
1140810004 16:78567790-78567812 ACCAGCAGAGCCTCCAGCCGGGG + Intronic
1141087986 16:81110409-81110431 TCCCTCTGACACTGCAGCCCTGG - Intergenic
1141930959 16:87202498-87202520 TCCACCTCATCCTCCATCCCAGG - Intronic
1142085526 16:88178208-88178230 TCCTGCCCACTCTCCAGCCCAGG - Intergenic
1142196024 16:88739686-88739708 CCCAGCAGCCCCTGCAGCCCTGG - Intronic
1142373671 16:89696237-89696259 TGCAGCTCAGCCTCCAGCCCAGG - Exonic
1142419747 16:89963045-89963067 CCCAGCTGCCTCCCCAGCCCTGG - Intronic
1143462670 17:7114248-7114270 TCCAGCTCCAGCTCCAGCCCGGG - Exonic
1144067064 17:11634166-11634188 CTCAGCTGAGCTTCCAGCCCAGG + Intronic
1144067997 17:11641604-11641626 TCCCGGGGACCCCCCAGCCCTGG + Intronic
1144310499 17:14009634-14009656 TCCAGGTGCCCTTCCATCCCTGG - Intergenic
1145014017 17:19385281-19385303 ACCAGCTGCCCCTCCTCCCCAGG - Exonic
1145176752 17:20707351-20707373 CCCAGCTGGTCCCCCAGCCCAGG + Intergenic
1145874492 17:28306915-28306937 TCCAGCTCACCTGCCGGCCCGGG - Intergenic
1146623071 17:34415294-34415316 TCCAGCCGTCCCTCAAGTCCGGG - Intergenic
1146624687 17:34426307-34426329 CCCAGCTAGCCCACCAGCCCAGG - Intergenic
1147142077 17:38465684-38465706 CCCAGCTGTCCCTCCATCCCCGG - Intronic
1147327039 17:39674583-39674605 TCCAGCTCCCCCTCCTGCACAGG - Intronic
1147614808 17:41821637-41821659 TCCTGCCCTCCCTCCAGCCCGGG + Exonic
1147910904 17:43855382-43855404 TGCAGCTCCCCATCCAGCCCTGG + Intronic
1148054036 17:44782973-44782995 TTCAGCTGACCCTCCAGATAGGG + Intergenic
1148552086 17:48556432-48556454 TCCTTCTGAGTCTCCAGCCCCGG + Intronic
1148759961 17:49994501-49994523 ACCAGGCGACCTTCCAGCCCCGG - Intronic
1148923131 17:51057399-51057421 GCCAGCTGACCCTTAAACCCAGG - Intronic
1149058279 17:52390606-52390628 TCCTGCTGACCCACAAGCCCAGG - Intergenic
1149552582 17:57551332-57551354 CCAAGCTGATTCTCCAGCCCAGG - Intronic
1149605124 17:57919084-57919106 TCCAAGTGATCCTCCTGCCCTGG + Intronic
1150338006 17:64344101-64344123 GCCAGCTCACCCTCCGACCCAGG + Intronic
1150472232 17:65446969-65446991 CCCAGCTGTCTTTCCAGCCCAGG - Intergenic
1151045652 17:70917172-70917194 TCCAGCTCCAGCTCCAGCCCTGG + Intergenic
1151045927 17:70919477-70919499 TCCAGCTCCAGCTCCAGCCCTGG + Intergenic
1151172635 17:72260030-72260052 TCCACCTGCCCCTCCTCCCCTGG - Intergenic
1151715712 17:75830111-75830133 TCCAGCTGACCTTGGAGCCCAGG - Exonic
1151727169 17:75891951-75891973 TCCAGCTGCCCCTCCCGCTGGGG - Intronic
1151957058 17:77385710-77385732 TCCACCTGACACCCCAGGCCTGG - Intronic
1152013477 17:77735023-77735045 TCCCGCTGCCCCTCCAGCCTAGG + Intergenic
1152038554 17:77888644-77888666 TTCAGGTGATCCTCCTGCCCCGG - Intergenic
1152210076 17:78998517-78998539 CCCAGCTCACCCTCCACCCCAGG + Intronic
1152253589 17:79224561-79224583 TCCAGGTGGCCCTGCGGCCCAGG + Intronic
1152425565 17:80216839-80216861 TCCGACTCACCCGCCAGCCCTGG - Intronic
1152678990 17:81656076-81656098 TCCAGCTGCTTCTCCAGCCCTGG + Intronic
1152704897 17:81838248-81838270 TTCAACTGACCCTCCAGCCTTGG - Intergenic
1152782141 17:82231266-82231288 TCCAGCCGTCCCTCCGGCCCGGG + Intronic
1153424065 18:4943984-4944006 TTTAGATGACCCTCAAGCCCAGG - Intergenic
1156969659 18:43139619-43139641 GCCAGCTGGCCCCCCAGCCCCGG + Intergenic
1157504872 18:48219082-48219104 TCCATCTGACCCTCAGGCCTGGG + Intronic
1157744262 18:50120963-50120985 TCCAGCCTGCCCTCCAGCCCGGG + Intronic
1159697500 18:71578847-71578869 TCCAGCCGACTCTGGAGCCCAGG - Intergenic
1159915256 18:74182578-74182600 TCCGCGGGACCCTCCAGCCCTGG + Intergenic
1160525351 18:79532382-79532404 TCCAGCAGACCCCCCCGCCTTGG + Intergenic
1160583657 18:79901238-79901260 CCCACCAGACCCTGCAGCCCAGG - Intergenic
1160679386 19:405808-405830 CCCAGCTGCTCCTCCAGTCCTGG + Exonic
1160734006 19:653558-653580 TCCAGCAGGCCCTTCAGCCCTGG - Intronic
1160842787 19:1154047-1154069 TCCACCTGACCTTCCTGGCCCGG - Intronic
1161073815 19:2275468-2275490 TGCAGCTGCCCCTCCAGGGCTGG - Exonic
1161633651 19:5373362-5373384 TGCAGCTGAACCCCCAGCTCCGG - Intergenic
1161989274 19:7675214-7675236 TTCAACTGATCCTCCAGCCTTGG - Intergenic
1162345195 19:10114618-10114640 TCCAGCTGTCCCTGTAGCCGGGG - Exonic
1162765730 19:12918397-12918419 TCCTGCCGACCCTTCAACCCTGG + Intronic
1162947938 19:14054893-14054915 TCCACCTTAGCCTCCAGCTCGGG + Exonic
1163042474 19:14612770-14612792 CCCACCCGACCCTCCTGCCCTGG + Intergenic
1163491891 19:17621732-17621754 CCCAGCTGCCCTTCCTGCCCAGG + Intronic
1165720153 19:38073328-38073350 TCCAGCTTTCCCACCAGGCCTGG + Intronic
1165940659 19:39413389-39413411 TCCCGGGGAGCCTCCAGCCCCGG - Exonic
1166076960 19:40419380-40419402 CCTAGCTGAGCCGCCAGCCCTGG - Intergenic
1166385088 19:42376349-42376371 CCCACCTGACCCTACTGCCCCGG + Exonic
1166791300 19:45400265-45400287 CACAGCTGCCCCTCCACCCCTGG - Intronic
1167220282 19:48194767-48194789 TCCAGCGCGCCCTGCAGCCCCGG - Exonic
1167374628 19:49104190-49104212 CCCAGCTGGGCCTCCTGCCCCGG + Intronic
1167914402 19:52728303-52728325 TTCAGATGATCCTCCAGCCTCGG - Intronic
1168242917 19:55096221-55096243 TCCAGCCACCCCGCCAGCCCTGG + Intronic
1168338774 19:55611972-55611994 TTCTCCTGACCCTCCACCCCCGG - Intronic
1168472814 19:56653177-56653199 TCCATCTCACTCCCCAGCCCTGG + Intronic
1202704876 1_KI270713v1_random:15184-15206 TCCTGCTGCCCATCCTGCCCGGG - Intergenic
925990354 2:9249735-9249757 TGCAGCTCCCCCGCCAGCCCGGG - Intronic
927291096 2:21405613-21405635 TCCAGTTGTCCCTTCACCCCTGG - Intergenic
927980239 2:27370398-27370420 TGCGGCTCAGCCTCCAGCCCAGG - Intronic
928403505 2:30996473-30996495 TCCACCTGCCTCTCCAGCACAGG - Intronic
928607151 2:32953452-32953474 TCCAGCTGACCCTCCCACATGGG - Intronic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
932219500 2:69989146-69989168 GAAAACTGACCCTCCAGCCCGGG - Intergenic
932420043 2:71596228-71596250 TCCAGCAGCCCCATCAGCCCAGG - Intronic
932557430 2:72837229-72837251 CCCAAGTGACCCTCCAGCCTTGG + Intergenic
932622095 2:73270750-73270772 TCCTGCTGCCCCTCCATCTCTGG + Intronic
934476092 2:94594595-94594617 TCCAGCTGTCCCAGCTGCCCCGG + Intronic
934518692 2:95005848-95005870 TGCAGCTGACCCTGCTGCCCAGG - Intergenic
934646332 2:96061324-96061346 CCCTGGTGACCCACCAGCCCAGG - Intergenic
934839735 2:97617406-97617428 CCCTGGTGACCCACCAGCCCAGG - Intergenic
935059203 2:99593330-99593352 TCGACCTGACCCTCCTGTCCAGG - Exonic
935805012 2:106737018-106737040 TAGAGCTGACCCTACAGTCCTGG + Intergenic
935929540 2:108109022-108109044 TTCAGATGACACTCCAGACCTGG - Intergenic
936522604 2:113220514-113220536 TCCACCAAACCCTCCAGCTCTGG - Intronic
938063522 2:128269354-128269376 CCCAGCGGACCAGCCAGCCCAGG + Intronic
938227516 2:129628496-129628518 TCCAGCCCTGCCTCCAGCCCTGG - Intergenic
939045514 2:137245444-137245466 TTCAGCTGCCCCTCCTTCCCGGG + Intronic
939079879 2:137647098-137647120 CCCAGCTGACCCATAAGCCCAGG + Intronic
940092367 2:149934777-149934799 TCCAGATGATACTACAGCCCTGG + Intergenic
941527860 2:166628637-166628659 TCAAGCTGACCTCCCAGCTCAGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942325767 2:174775992-174776014 TCCAGGTTACTCTCCAGACCTGG + Intergenic
944295180 2:198053467-198053489 TCCTTCTGTCCCTCCAGCCAAGG + Intronic
945010753 2:205460939-205460961 ACCAGCTTAGCCTCCAGTCCAGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947593618 2:231397997-231398019 TCAACTTGACCCACCAGCCCTGG + Exonic
948995820 2:241577709-241577731 TCAAGGTGCCCCTCCTGCCCAGG + Intergenic
1168803185 20:656866-656888 TCCAGCTGCCCTTGCAGCCAGGG - Intronic
1168953237 20:1816940-1816962 TCCAGCAGCCCCTTCATCCCAGG - Intergenic
1169089517 20:2850086-2850108 CCCAGCTGACCCACCAGCATTGG - Intronic
1169767226 20:9160082-9160104 TCCAGCTCACCCTGCTGTCCTGG - Intronic
1170964361 20:21052902-21052924 TCCTGCTGACACTCCCTCCCAGG - Intergenic
1171137787 20:22712573-22712595 TTCAGATGACACTGCAGCCCTGG - Intergenic
1171348701 20:24486287-24486309 TCCACCTGGCTCCCCAGCCCAGG - Intronic
1171458732 20:25286673-25286695 TCCAGAGGAGCCTCCCGCCCAGG - Intronic
1171469737 20:25360787-25360809 TCCACCTGATCCTCCCGCCACGG - Intronic
1171767800 20:29299879-29299901 GGCACCTGACCCTCCAGCCGGGG + Intergenic
1172464582 20:35146754-35146776 CCCAGCTGACCCGCCCGCCGAGG + Intronic
1173017154 20:39236066-39236088 TCCAGCTGACTGTCCAGCTGGGG + Intergenic
1173255737 20:41393252-41393274 TGCAGCTGCTCCTGCAGCCCTGG + Intergenic
1174029596 20:47611826-47611848 TCCTTCTGCCCCTCCAGACCAGG + Intronic
1174085867 20:48006772-48006794 TCCACCCACCCCTCCAGCCCTGG - Intergenic
1174130391 20:48340178-48340200 TCCACCTGCCCCTCCAGCCCTGG + Intergenic
1174171362 20:48620007-48620029 TGCAGCTGGCCCTGCTGCCCTGG - Intergenic
1174361485 20:50031516-50031538 TCCAGCTGGCCCCACACCCCAGG - Intergenic
1175255874 20:57646869-57646891 TCCAGCTGCCTGTCCACCCCTGG - Intergenic
1175335712 20:58194596-58194618 CCCAGCTGTGCCTCTAGCCCAGG + Intergenic
1175809743 20:61851635-61851657 TCTGGCTGACCATCCAGCTCTGG + Intronic
1177554256 21:22669383-22669405 TCCACCTGACCCTCCACCAGTGG + Intergenic
1178414007 21:32389218-32389240 TCCAGTGTACCCTCCAGCCTTGG - Intronic
1178666245 21:34549555-34549577 TGCTGGTGACCCTCCAGTCCAGG + Intronic
1179081466 21:38174429-38174451 CTCAGATGACCTTCCAGCCCTGG + Intronic
1179178640 21:39026849-39026871 TTCAGGTGATCCTCCAGCCTTGG + Intergenic
1179460225 21:41529516-41529538 ACCGGCTGACCCTCCCTCCCTGG - Intronic
1179478634 21:41663977-41663999 TCCAAGTGACCCTCCTGCCAGGG - Intergenic
1179488887 21:41727780-41727802 TCCAGGTCACCCTGCACCCCTGG + Intergenic
1179544649 21:42106059-42106081 CACAGCTGACCCCCCAGCTCAGG - Intronic
1179898869 21:44378610-44378632 TCCAGCACACCCTGGAGCCCAGG + Intronic
1180138239 21:45875211-45875233 TCCAGCTGACTCACCGGGCCTGG + Intronic
1180242948 21:46524050-46524072 TCCAGCTGTCCCGTCAGCTCTGG + Intronic
1180285979 22:10744823-10744845 TTCAGGTGATCCTCCTGCCCTGG + Intergenic
1181038068 22:20179376-20179398 TCCAGGTGGGCCTCAAGCCCAGG - Intergenic
1181458340 22:23071739-23071761 CTCACCTGACCCCCCAGCCCAGG - Intronic
1181627614 22:24132382-24132404 TGCAGCTGACCCTCCCTCCTTGG + Intronic
1181684919 22:24521787-24521809 TCCTGCTGAGCAGCCAGCCCTGG - Intronic
1181943338 22:26496137-26496159 CCAAGCTCATCCTCCAGCCCTGG - Exonic
1182364590 22:29769777-29769799 TCAAGCTGAGGCTCCAGCTCTGG - Exonic
1182473662 22:30564114-30564136 ACCAGCTGACCCTCCATCACAGG + Intronic
1182769566 22:32784517-32784539 TCCAGATGAAACTGCAGCCCTGG + Intronic
1183165475 22:36144273-36144295 TCCTGCTGCTCCTCCAACCCAGG + Intronic
1183540299 22:38426091-38426113 CCCTGCAGTCCCTCCAGCCCCGG - Intergenic
1183604913 22:38862710-38862732 TGGGGCTGACCCTCCAGCCTTGG + Exonic
1183856032 22:40636048-40636070 TCCAGCTGAGCCTCCTTGCCTGG + Intronic
1184093166 22:42302850-42302872 TCAACCAGAGCCTCCAGCCCTGG + Intronic
1184330296 22:43823011-43823033 TCCAGGTGACCCTCAACCTCAGG + Intergenic
1185408739 22:50672150-50672172 TCCTGCCAACCCACCAGCCCAGG - Intergenic
1203296110 22_KI270736v1_random:44464-44486 TCTGGCTGACCCTACACCCCCGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950153763 3:10707774-10707796 TCCGGCTCACGCTCCCGCCCTGG + Intronic
950427100 3:12930397-12930419 CCCAGCCTACCCTCCAGCTCAGG + Intronic
950529868 3:13547057-13547079 TGCAGCTCACTCTGCAGCCCAGG - Intergenic
950675906 3:14554369-14554391 TTCATCTGTCCCTCCAGCCTGGG + Intergenic
951556999 3:23930912-23930934 CCCAGCTGATCCTCCTGCCTTGG + Intronic
952368334 3:32694956-32694978 CCCAGGTGATCCTCCTGCCCTGG + Intronic
952925506 3:38316725-38316747 TCCTGCTGCCCCTCCTGACCCGG + Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953837206 3:46357057-46357079 TCCACCTGCCCCTCCTGCTCTGG - Intronic
953903810 3:46858230-46858252 TCCAGCTAAACCTCGTGCCCAGG - Exonic
953918480 3:46935761-46935783 TCCAGCAGCTCCACCAGCCCAGG - Intronic
953927543 3:46990050-46990072 CCCTGGTGACCCTCCACCCCTGG + Intronic
954031648 3:47824376-47824398 TTCACCTTCCCCTCCAGCCCTGG + Intronic
954208498 3:49078923-49078945 TTCAGGTGACCCTCCCGCCTCGG + Intronic
954614148 3:51960955-51960977 TCCAGCTGAGGCTTCAGCCCAGG - Intronic
955972337 3:64447732-64447754 GCCAGGTGAGCATCCAGCCCTGG - Intergenic
957036415 3:75297395-75297417 TCCAGGTGACCAGCCATCCCTGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961161449 3:124730313-124730335 TCCACCTGACCCTTGAGCCCGGG + Intergenic
961530697 3:127538228-127538250 TCTAGCTCACACTCCAGACCGGG + Intergenic
962320897 3:134389432-134389454 TCCAACTCACTCTCCATCCCAGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964508058 3:157421264-157421286 AACTGTTGACCCTCCAGCCCTGG + Intronic
966076051 3:175937471-175937493 GCCAGCTGCCCTGCCAGCCCCGG + Intergenic
966984427 3:185166442-185166464 TCCAGCTGAGACTCCAGACATGG - Intergenic
968350792 3:198050178-198050200 TCCAGCTGCAGCTCCAGCCATGG - Intergenic
968595270 4:1479092-1479114 TGCAGCTGAGCCTCCACCCAAGG + Intergenic
969723884 4:8907894-8907916 TGCAGCCTGCCCTCCAGCCCAGG - Intergenic
972783581 4:42306935-42306957 TCCAAATGACCCACAAGCCCTGG + Intergenic
973621505 4:52731079-52731101 TCCTGCTCCCCCCCCAGCCCTGG + Intronic
977445286 4:97124009-97124031 GCCTGCTGTCCCTCCACCCCTGG + Intergenic
980592572 4:134910285-134910307 TGCAGCTGGCCCTACAGCCAGGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
981260762 4:142715924-142715946 TCCAGCTGACAGTCCAGCTAAGG - Intronic
984486667 4:180378904-180378926 TCTGGCTGACTCTCCAACCCAGG + Intergenic
985671973 5:1211286-1211308 TCCAGAGGACCCCACAGCCCCGG - Intronic
986737183 5:10676421-10676443 CCCAGATGTCTCTCCAGCCCTGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
989331815 5:40268638-40268660 CCCAACTGATCCTCCAGCCTTGG - Intergenic
993487454 5:88504171-88504193 TCCAGCTATCCCTGAAGCCCTGG - Intergenic
993524442 5:88946728-88946750 TCCAGTTTGCACTCCAGCCCAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995390258 5:111632908-111632930 TCCAGCTTACCCTGCACCCTAGG - Intergenic
995435199 5:112127864-112127886 TTCTTCTCACCCTCCAGCCCAGG + Intergenic
996780604 5:127182620-127182642 CCCACCTGACCCAGCAGCCCAGG - Intergenic
997370532 5:133356906-133356928 ACCAGCTCAGCCTCCAGCACAGG - Intronic
997471674 5:134120723-134120745 TCCAGCTGCCTTGCCAGCCCTGG + Intronic
997669345 5:135657704-135657726 TGCTGCTGACACTCCTGCCCAGG - Intergenic
998156234 5:139788560-139788582 TCCAGCTGGCCGTCCAGGCCTGG - Intergenic
999769523 5:154764669-154764691 TTCAACTGACCCTCCCGCCTCGG - Intronic
999775718 5:154811718-154811740 TCCAGCTGTGCCCCTAGCCCAGG + Intronic
1000765354 5:165282697-165282719 TCCAGCTGAAATTCAAGCCCAGG - Intergenic
1001216860 5:169864335-169864357 CCCAGCAGAACCCCCAGCCCCGG - Exonic
1001339774 5:170832430-170832452 GCAAGCTGACCGTCCAGACCTGG - Intergenic
1001580735 5:172796561-172796583 GTCAGGTGACCGTCCAGCCCAGG + Intergenic
1001844533 5:174910297-174910319 TCCAGCCCACTCCCCAGCCCAGG + Intergenic
1002424141 5:179165856-179165878 TCCAGGGGCCCATCCAGCCCAGG + Intronic
1002441326 5:179265880-179265902 TGGAGCTGAGCCTGCAGCCCAGG - Intronic
1004515837 6:16321628-16321650 CCCAGCTGACGCTCCAGACGAGG - Intronic
1004919078 6:20359221-20359243 TTCAGGTGACCCACCAGCCTCGG + Intergenic
1005842530 6:29752995-29753017 TCCAGCTGCTCCGCCACCCCAGG + Intergenic
1006010996 6:31042892-31042914 TCCAGCTTCCCCTGCAGCCCAGG + Intergenic
1007772602 6:44203173-44203195 TCCAGCTGTCTGTGCAGCCCAGG + Intergenic
1008092798 6:47309539-47309561 TCCAGCTGCCCCGCGCGCCCCGG - Exonic
1015275678 6:131381300-131381322 TCCAGCTGTCGCTCCAGCTGGGG + Intergenic
1015665725 6:135626357-135626379 TCCAGCTGACCCAGAAGCCCAGG + Intergenic
1017491034 6:154945309-154945331 ACCACCAGCCCCTCCAGCCCCGG + Intronic
1018649520 6:165981057-165981079 TGCACCTGACCCTCCACTCCAGG - Intronic
1018757300 6:166861516-166861538 TCCTGCACACCCACCAGCCCTGG + Intronic
1018954343 6:168398122-168398144 TCCAGCCGACACTTCAGACCAGG - Intergenic
1019390464 7:783886-783908 ACCAGCTCAGCCTGCAGCCCCGG + Intronic
1019429809 7:993452-993474 TCAAGCTGACCTTCCAGCCCGGG - Intergenic
1020097720 7:5377852-5377874 TCCAGCTGCCCCTCACCCCCAGG + Intronic
1021817641 7:24463759-24463781 TCCACCTGCCTCTCCATCCCAGG - Intergenic
1023135351 7:37045973-37045995 CCCAGCTGGCCCTTGAGCCCAGG + Intronic
1025020628 7:55476723-55476745 CCCAGCTGCTCCTCCAGCCATGG + Intronic
1025187276 7:56871088-56871110 TCTGGCTGATCCTCAAGCCCTGG + Intergenic
1025684649 7:63705832-63705854 TCTGGCTGATCCTCAAGCCCTGG - Intergenic
1026048045 7:66921467-66921489 CCCAGCCCGCCCTCCAGCCCCGG - Intronic
1026901675 7:74040749-74040771 TCCAGCCTGCCCTGCAGCCCAGG - Intronic
1028753121 7:94404859-94404881 TCCAGCTGGCCCTCCTGGCAAGG + Exonic
1028778309 7:94705592-94705614 GCCAGCTGGCCCTGCCGCCCCGG + Intergenic
1029524767 7:101087952-101087974 GCCAGCAGTCCCTCCAGGCCCGG - Exonic
1030042256 7:105462196-105462218 TTCAGGTGATCCTCCTGCCCCGG - Intronic
1034162373 7:149002860-149002882 TCCAGCGGAGCCGCCACCCCAGG + Intergenic
1034421886 7:150994998-150995020 ACCAGCAGCCCCTGCAGCCCAGG + Intronic
1034446720 7:151117452-151117474 TCCAGGTGATGCTCCTGCCCAGG + Exonic
1034622315 7:152464888-152464910 TCCAGCAAACCCTGCATCCCAGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035032488 7:155870521-155870543 TCCATCTGATCCTCCAAGCCAGG + Intergenic
1035048769 7:155986162-155986184 TCCAGCTGCCCAGCCAGGCCAGG + Intergenic
1035327521 7:158074623-158074645 TCCAGCTTCCCCTCCACCTCGGG - Intronic
1036615180 8:10382241-10382263 TCCAGCAGGCCCAGCAGCCCAGG + Intronic
1036656195 8:10678983-10679005 TCCAGCTGCACCTCCTTCCCGGG + Intronic
1037310444 8:17550027-17550049 TCCAGCTGAACCCACAGCCAGGG - Intronic
1037772137 8:21808570-21808592 CGCAGCTGAGCCTCCAGCGCAGG + Intronic
1038781717 8:30573874-30573896 TCCAGCTGAGTCTGAAGCCCAGG - Intergenic
1040323946 8:46331831-46331853 GCCAGCTGACCCACCAGCCCCGG + Intergenic
1040985519 8:53290223-53290245 TCTTGCTGTCCCTCTAGCCCAGG + Intergenic
1041325846 8:56663118-56663140 TACAGCAGATCCTCTAGCCCCGG - Intergenic
1042151440 8:65790204-65790226 GCCAGATGACGCTGCAGCCCTGG + Intronic
1042892694 8:73630698-73630720 CTGAGCTGGCCCTCCAGCCCAGG - Intronic
1043492071 8:80759730-80759752 TCCAGATGATACTCCAGCCCTGG + Intronic
1043571038 8:81602600-81602622 GCCAGGTGACCCTCCAGACCTGG + Intergenic
1044590072 8:93905748-93905770 TTCAGGTGACTCTGCAGCCCTGG + Intronic
1044880962 8:96721759-96721781 TCCAGCTCTCTCTCCAGCCTTGG + Intronic
1046757221 8:117984341-117984363 TCCACCTCACCCTGCACCCCAGG - Intronic
1047811004 8:128409202-128409224 TGTAGCAGAGCCTCCAGCCCTGG - Intergenic
1049003599 8:139841252-139841274 AGCAGCTGACCTTCAAGCCCAGG - Intronic
1049058092 8:140254646-140254668 TCCTGGTGCCCCTCCAGCCTAGG + Intronic
1049245470 8:141560085-141560107 TCCAGCAGACATTCCAGGCCTGG - Intergenic
1049296492 8:141843213-141843235 TCCGGGTGACCCCCCAGCCTGGG + Intergenic
1049387185 8:142348960-142348982 TGCAGCTGACCCTACACCCATGG + Intronic
1049410548 8:142472031-142472053 ACTGACTGACCCTCCAGCCCCGG + Intronic
1049444429 8:142623509-142623531 GCCAGCTGCCTCTCCACCCCTGG - Intergenic
1049619676 8:143592413-143592435 AGCTGCTGACCCGCCAGCCCAGG + Intronic
1049822703 8:144645819-144645841 CCCAGCTCCCCCTGCAGCCCTGG - Intergenic
1050353685 9:4763410-4763432 ACCAGCTCAGCCTCCAGCTCTGG - Intergenic
1050952826 9:11618697-11618719 ACCAGCTGCCTCACCAGCCCTGG - Intergenic
1053123623 9:35562903-35562925 TCCAGCTGCCCCTCCGGCTCTGG + Exonic
1053681965 9:40491483-40491505 TCCAGCTGTCCCAGCTGCCCCGG - Intergenic
1054281748 9:63133449-63133471 TCCAGCTGTCCCAGCTGCCCCGG + Intergenic
1054295061 9:63326986-63327008 TCCAGCTGTCCCAGCTGCCCCGG - Intergenic
1054393083 9:64631486-64631508 TCCAGCTGTCCCAGCTGCCCCGG - Intergenic
1054427732 9:65136696-65136718 TCCAGCTGTCCCAGCTGCCCCGG - Intergenic
1054502644 9:65884842-65884864 TCCAGCTGTCCCAGCTGCCCCGG + Intronic
1054709665 9:68498714-68498736 CCTAGCTGAGGCTCCAGCCCTGG + Intronic
1054746005 9:68854361-68854383 CCCAGGTGATCCTCCTGCCCTGG + Intronic
1055476521 9:76668562-76668584 TCCACCTCACCCTCCCACCCAGG - Intronic
1055529308 9:77168007-77168029 TCCAGCTGATCCGCCTGCCTAGG + Intergenic
1056235081 9:84586442-84586464 TCCCTCTGTCCCTCCAGCCAAGG + Intergenic
1056767129 9:89451481-89451503 TCCAGTTGAGCTTCCAGCTCAGG - Intronic
1057592319 9:96383442-96383464 TCCCGCAGACCCCCCGGCCCCGG + Intronic
1058281774 9:103125433-103125455 TGCAGCTGAGTCTCCAGGCCTGG - Intergenic
1059415868 9:114162236-114162258 TCCCGCTGACCTTTCACCCCTGG + Intronic
1061080196 9:128365262-128365284 TCCAGCAGGCCGGCCAGCCCGGG - Intergenic
1061574792 9:131499403-131499425 TCCAGCAGACCCTCTAACCCAGG - Exonic
1062061259 9:134496482-134496504 CCCAGCTGACCCTGCCACCCTGG - Intergenic
1062128947 9:134882362-134882384 TCCAGGTGACCCTCCAGCTGAGG + Intronic
1062212188 9:135371159-135371181 TCCAGCTCCCCCTGCTGCCCAGG + Intergenic
1062359940 9:136182927-136182949 TCCTTCTCACCCTTCAGCCCGGG - Intergenic
1062631422 9:137464796-137464818 CCTCGCTGACCCTCCAGCCACGG - Intronic
1062645581 9:137546549-137546571 TGAAGCTGCCCCTCCAGGCCAGG + Intronic
1203732328 Un_GL000216v2:101891-101913 TTCAGGTGATCCTCCCGCCCTGG + Intergenic
1186334378 X:8570681-8570703 TCCATCTGCCCCACCAGCACCGG - Exonic
1186520778 X:10205005-10205027 CCCAGCTAACCCCCCAGCCCAGG - Intronic
1186634236 X:11384893-11384915 CCCAGCAAACCCTCCAGTCCTGG + Intronic
1188961580 X:36499668-36499690 TCCATCTGGCCATCTAGCCCAGG + Intergenic
1190688358 X:52893642-52893664 TCCAGTCTACCCTCCAGCCAGGG + Intronic
1190697625 X:52962150-52962172 TCCAGTCTACCCTCCAGCCAGGG - Intronic
1190748891 X:53344031-53344053 TTCAGATGAGACTCCAGCCCTGG - Intergenic
1192221832 X:69202715-69202737 TTGAGCAGACCCTCCAGACCAGG - Intergenic
1192274482 X:69615945-69615967 TCCAGCCGGGCCTCCAGCCGCGG - Intergenic
1192412918 X:70950710-70950732 TCCAGCTCAGACTCCAACCCTGG - Intergenic
1193170850 X:78333793-78333815 ACCAGCTAACCCTCTAGCCAAGG + Intergenic
1194270470 X:91807888-91807910 TCTAGCTGAACCTTCATCCCTGG - Intronic
1198251190 X:134880625-134880647 TCCAGGAGACACTGCAGCCCAGG + Intergenic
1199741311 X:150739104-150739126 TCCAGCTGTCCCTGCACTCCTGG + Intronic
1200587704 Y:5029316-5029338 TCTAGCTGAACCTTCATCCCTGG - Intronic
1200787812 Y:7274649-7274671 TGGAGCGCACCCTCCAGCCCCGG + Intergenic
1200827651 Y:7660399-7660421 TCTACCTCACCCTGCAGCCCGGG - Intergenic
1200884459 Y:8254002-8254024 TCTAGATGACCCCGCAGCCCGGG - Intergenic
1201272915 Y:12272751-12272773 TTCAGCTGATCCACCTGCCCTGG + Intergenic
1202107420 Y:21385413-21385435 TCTACCTGACCCCGCAGCCCGGG - Intronic
1202232198 Y:22669246-22669268 TCTACATGACCCTGCAGCCCAGG + Intergenic
1202310958 Y:23526912-23526934 TCTACATGACCCTGCAGCCCAGG - Intergenic
1202559844 Y:26143682-26143704 TCTACATGACCCTGCAGCCCAGG + Intergenic