ID: 1133346143

View in Genome Browser
Species Human (GRCh38)
Location 16:5071857-5071879
Sequence CGCCAGCAGGACCAAGCATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133346143_1133346150 25 Left 1133346143 16:5071857-5071879 CCTCATGCTTGGTCCTGCTGGCG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1133346150 16:5071905-5071927 TGCTGGGAGGATGGAAGCGCTGG 0: 1
1: 0
2: 1
3: 27
4: 349
1133346143_1133346146 9 Left 1133346143 16:5071857-5071879 CCTCATGCTTGGTCCTGCTGGCG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1133346146 16:5071889-5071911 CTGCTGCCGCTGCTGCTGCTGGG 0: 3
1: 37
2: 91
3: 263
4: 900
1133346143_1133346149 16 Left 1133346143 16:5071857-5071879 CCTCATGCTTGGTCCTGCTGGCG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1133346149 16:5071896-5071918 CGCTGCTGCTGCTGGGAGGATGG 0: 1
1: 1
2: 12
3: 70
4: 691
1133346143_1133346147 12 Left 1133346143 16:5071857-5071879 CCTCATGCTTGGTCCTGCTGGCG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1133346147 16:5071892-5071914 CTGCCGCTGCTGCTGCTGGGAGG 0: 1
1: 6
2: 37
3: 174
4: 803
1133346143_1133346145 8 Left 1133346143 16:5071857-5071879 CCTCATGCTTGGTCCTGCTGGCG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1133346145 16:5071888-5071910 GCTGCTGCCGCTGCTGCTGCTGG 0: 4
1: 112
2: 246
3: 611
4: 1666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133346143 Original CRISPR CGCCAGCAGGACCAAGCATG AGG (reversed) Exonic