ID: 1133346144

View in Genome Browser
Species Human (GRCh38)
Location 16:5071870-5071892
Sequence GCAGCAGACACAGCGCCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 293}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133346144_1133346154 21 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346154 16:5071914-5071936 GATGGAAGCGCTGGCGCCGGGGG 0: 1
1: 0
2: 0
3: 11
4: 123
1133346144_1133346149 3 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346149 16:5071896-5071918 CGCTGCTGCTGCTGGGAGGATGG 0: 1
1: 1
2: 12
3: 70
4: 691
1133346144_1133346145 -5 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346145 16:5071888-5071910 GCTGCTGCCGCTGCTGCTGCTGG 0: 4
1: 112
2: 246
3: 611
4: 1666
1133346144_1133346157 28 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346157 16:5071921-5071943 GCGCTGGCGCCGGGGGCGGGCGG 0: 1
1: 1
2: 11
3: 104
4: 1007
1133346144_1133346146 -4 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346146 16:5071889-5071911 CTGCTGCCGCTGCTGCTGCTGGG 0: 3
1: 37
2: 91
3: 263
4: 900
1133346144_1133346152 19 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346152 16:5071912-5071934 AGGATGGAAGCGCTGGCGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 144
1133346144_1133346153 20 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346153 16:5071913-5071935 GGATGGAAGCGCTGGCGCCGGGG 0: 1
1: 1
2: 1
3: 10
4: 119
1133346144_1133346156 25 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346156 16:5071918-5071940 GAAGCGCTGGCGCCGGGGGCGGG 0: 1
1: 0
2: 4
3: 36
4: 360
1133346144_1133346150 12 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346150 16:5071905-5071927 TGCTGGGAGGATGGAAGCGCTGG 0: 1
1: 0
2: 1
3: 27
4: 349
1133346144_1133346155 24 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346155 16:5071917-5071939 GGAAGCGCTGGCGCCGGGGGCGG 0: 1
1: 0
2: 4
3: 28
4: 426
1133346144_1133346147 -1 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346147 16:5071892-5071914 CTGCCGCTGCTGCTGCTGGGAGG 0: 1
1: 6
2: 37
3: 174
4: 803
1133346144_1133346151 18 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346151 16:5071911-5071933 GAGGATGGAAGCGCTGGCGCCGG 0: 1
1: 0
2: 2
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133346144 Original CRISPR GCAGCAGACACAGCGCCAGC AGG (reversed) Exonic