ID: 1133346150

View in Genome Browser
Species Human (GRCh38)
Location 16:5071905-5071927
Sequence TGCTGGGAGGATGGAAGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 349}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133346143_1133346150 25 Left 1133346143 16:5071857-5071879 CCTCATGCTTGGTCCTGCTGGCG 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1133346150 16:5071905-5071927 TGCTGGGAGGATGGAAGCGCTGG 0: 1
1: 0
2: 1
3: 27
4: 349
1133346144_1133346150 12 Left 1133346144 16:5071870-5071892 CCTGCTGGCGCTGTGTCTGCTGC 0: 1
1: 0
2: 6
3: 28
4: 293
Right 1133346150 16:5071905-5071927 TGCTGGGAGGATGGAAGCGCTGG 0: 1
1: 0
2: 1
3: 27
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133346150 Original CRISPR TGCTGGGAGGATGGAAGCGC TGG Exonic