ID: 1133346753

View in Genome Browser
Species Human (GRCh38)
Location 16:5076213-5076235
Sequence CTGGACATGCACACGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133346753_1133346761 14 Left 1133346753 16:5076213-5076235 CCAGCCTCCGTGTGCATGTCCAG 0: 1
1: 0
2: 1
3: 14
4: 214
Right 1133346761 16:5076250-5076272 TCCGGCCTTGGGCCATTGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 98
1133346753_1133346764 20 Left 1133346753 16:5076213-5076235 CCAGCCTCCGTGTGCATGTCCAG 0: 1
1: 0
2: 1
3: 14
4: 214
Right 1133346764 16:5076256-5076278 CTTGGGCCATTGGCTGGCTGTGG 0: 1
1: 0
2: 2
3: 21
4: 247
1133346753_1133346758 2 Left 1133346753 16:5076213-5076235 CCAGCCTCCGTGTGCATGTCCAG 0: 1
1: 0
2: 1
3: 14
4: 214
Right 1133346758 16:5076238-5076260 GCTGCGTGTACTTCCGGCCTTGG 0: 1
1: 0
2: 0
3: 1
4: 51
1133346753_1133346757 -4 Left 1133346753 16:5076213-5076235 CCAGCCTCCGTGTGCATGTCCAG 0: 1
1: 0
2: 1
3: 14
4: 214
Right 1133346757 16:5076232-5076254 CCAGCTGCTGCGTGTACTTCCGG 0: 1
1: 0
2: 2
3: 104
4: 2588
1133346753_1133346760 10 Left 1133346753 16:5076213-5076235 CCAGCCTCCGTGTGCATGTCCAG 0: 1
1: 0
2: 1
3: 14
4: 214
Right 1133346760 16:5076246-5076268 TACTTCCGGCCTTGGGCCATTGG 0: 1
1: 0
2: 0
3: 5
4: 78
1133346753_1133346759 3 Left 1133346753 16:5076213-5076235 CCAGCCTCCGTGTGCATGTCCAG 0: 1
1: 0
2: 1
3: 14
4: 214
Right 1133346759 16:5076239-5076261 CTGCGTGTACTTCCGGCCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133346753 Original CRISPR CTGGACATGCACACGGAGGC TGG (reversed) Intronic
900207168 1:1436475-1436497 CTGGGCATGCACACAGCAGCAGG - Intronic
900313356 1:2045206-2045228 CGGCACATGCACACAGAGGCGGG + Intergenic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900572258 1:3364470-3364492 CTGGACAAGCCCCCGGAGGATGG + Intronic
901919923 1:12528572-12528594 GTGGACTTGCACACGCAAGCAGG + Intergenic
902637605 1:17744844-17744866 CAGCACATGCTCAAGGAGGCAGG - Intergenic
905311352 1:37051330-37051352 CTGCACATGCCCACAGAGGCAGG - Intergenic
905314629 1:37074095-37074117 CTGAGCAAGCGCACGGAGGCAGG + Intergenic
905798819 1:40830643-40830665 CTGGCCATGCACACGGAGGTAGG - Intronic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
916245808 1:162687124-162687146 CTGGACATGAAGACAGTGGCAGG - Intronic
920045537 1:203129931-203129953 CTGGACACCCACACTGAGGACGG - Intronic
920376004 1:205508347-205508369 ATGCACATGCACACACAGGCTGG + Intronic
923902059 1:238336656-238336678 CTGCACGTGCACACTGGGGCTGG + Intergenic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1064662686 10:17622291-17622313 CTGATCATGAACACGGGGGCGGG + Intergenic
1067097195 10:43309532-43309554 CTGGGCATGCCCACAGGGGCAGG + Intergenic
1067787699 10:49262653-49262675 TTGGACATTCACACTGAGGATGG + Intergenic
1069895968 10:71680241-71680263 CTGGACAGCCAAAGGGAGGCAGG - Intronic
1070588068 10:77781075-77781097 CTGGACCTGCTCACCCAGGCGGG - Intergenic
1071369338 10:84935273-84935295 CTGGACATACATGAGGAGGCTGG + Intergenic
1071480938 10:86064505-86064527 CTGGCCCAGCACACTGAGGCAGG - Intronic
1072534452 10:96351058-96351080 GTGGTCACGCACAAGGAGGCTGG - Intronic
1076184857 10:128438245-128438267 CTGGGCATGGACACGGACTCAGG + Intergenic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1077046803 11:550290-550312 CTGGCCATGCACATGCTGGCCGG - Intronic
1078003364 11:7514418-7514440 CTGGAGATGCGCAGGGAGGTGGG + Intronic
1080091790 11:28356999-28357021 CTGGATATGCCTACGGAGTCAGG - Intergenic
1081734182 11:45391867-45391889 CTGGACAAGCACACCTAAGCTGG + Intergenic
1082805432 11:57446395-57446417 CTGAAGATGAACAGGGAGGCAGG + Intergenic
1083023755 11:59532542-59532564 CTGGGCATGCACATAGATGCAGG - Intergenic
1083300786 11:61738755-61738777 GTGGCCAGGCACACTGAGGCAGG + Intronic
1083431407 11:62615373-62615395 CTGGGCATGCACTGGGGGGCTGG - Exonic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1085159028 11:74324025-74324047 CTGTACATTGAGACGGAGGCAGG - Intergenic
1085473702 11:76774449-76774471 CTGGACAGGGAAACTGAGGCAGG - Intergenic
1090860825 11:130651020-130651042 CAGGACATGCACACGGGGATGGG - Intergenic
1091850410 12:3692714-3692736 CTGAACACCCACACAGAGGCAGG - Intronic
1094287923 12:28815560-28815582 CTGGACTTGCACACCAGGGCTGG + Intergenic
1094853494 12:34392751-34392773 CTGGACATGCACGCTGGGGAGGG - Intergenic
1095991367 12:48036885-48036907 TTGGACAGGCACACACAGGCTGG - Intergenic
1096071218 12:48776440-48776462 CTGGCCAACCACATGGAGGCAGG - Exonic
1098218515 12:68244323-68244345 CTGGATATGCCCACATAGGCAGG - Intergenic
1103935966 12:124476817-124476839 CTGGACATGGAGGCCGAGGCAGG + Intronic
1104558549 12:129823628-129823650 CTGGTCAGGAACACAGAGGCAGG + Intronic
1104602764 12:130164050-130164072 CTGGTCATGCGCAGGGTGGCGGG + Exonic
1104667663 12:130658814-130658836 ATGGTCTTGCACAGGGAGGCGGG + Intronic
1107599333 13:41996978-41997000 CTAGACATGAACATGGAGGTAGG + Intergenic
1107808160 13:44174326-44174348 CTGGACATGCCCTCAGGGGCAGG - Intergenic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1118646511 14:67846189-67846211 ATGAATATGCACACAGAGGCTGG - Intronic
1119085684 14:71736943-71736965 CTGGACAGACACAACGAGGCTGG - Intronic
1120904359 14:89607590-89607612 CTGCCCATGCACACAGAGGTGGG + Intronic
1120920310 14:89749052-89749074 CTGGACACTTACACGGTGGCTGG + Intergenic
1121216616 14:92253460-92253482 GTGGAGATGCACAAGGAGTCAGG + Intergenic
1121682264 14:95803489-95803511 CTGGAAATGCTCAGTGAGGCTGG + Intergenic
1122646258 14:103196420-103196442 CAGCACATGAAGACGGAGGCAGG - Intergenic
1122784086 14:104155921-104155943 CTGGACAGGGGCACCGAGGCTGG - Intronic
1122890218 14:104728795-104728817 CTGGGGATGGACACAGAGGCAGG + Intronic
1128635749 15:69301298-69301320 CTGGAAAAGCACATGGGGGCTGG - Intronic
1129777107 15:78244001-78244023 CTGGACATCAACAAGGAGGGTGG - Intronic
1132329385 15:101001136-101001158 CTTTACATGCACAAGGATGCTGG + Intronic
1132498353 16:274232-274254 CTGGACAAGTACCCTGAGGCCGG - Exonic
1133346753 16:5076213-5076235 CTGGACATGCACACGGAGGCTGG - Intronic
1138475830 16:57270265-57270287 CTGGAGATGGACTCGGGGGCTGG - Intronic
1140968836 16:79993475-79993497 CTGGGCATGCAAACAGAAGCTGG - Intergenic
1142226545 16:88880453-88880475 CTGGACCTGCACACCCAGGAGGG - Intronic
1143099962 17:4499396-4499418 CTGGACAGGTACACCGTGGCAGG + Exonic
1144706333 17:17370831-17370853 CTAGACGTGCACACGGGAGCTGG + Intergenic
1148444543 17:47729520-47729542 CTGGGTATGCACACTGAGGGCGG - Intergenic
1148606696 17:48934952-48934974 CTGGACTCGCACATAGAGGCTGG + Intronic
1149282600 17:55124883-55124905 TTGTACATGCACACAGAGGAGGG + Intronic
1151533982 17:74726973-74726995 CTCTACATGCACCCAGAGGCTGG - Intronic
1151940542 17:77288869-77288891 CTGCAAGTGCACACAGAGGCCGG + Intronic
1152615476 17:81335981-81336003 CTGGGCATGCTCAAGGAGGGCGG - Intergenic
1152914637 17:83027134-83027156 CTGGACAGACACACGGAGGGGGG + Intronic
1153227083 18:2907250-2907272 CTAGTCCAGCACACGGAGGCCGG + Intronic
1155047237 18:22113630-22113652 CTGGGCATGCAGCCTGAGGCTGG + Intergenic
1155362318 18:25015795-25015817 CAGGACAAGCCCACTGAGGCTGG - Intergenic
1156148439 18:34214651-34214673 CTGGATATGTACACAGAAGCAGG - Intronic
1157225887 18:45864222-45864244 CTGGGCATGGAGGCGGAGGCAGG - Intronic
1160958666 19:1707218-1707240 CTGGACAAGGACACCAAGGCGGG - Intergenic
1161576299 19:5056297-5056319 CTGGACATCCACACCCAAGCCGG - Intronic
1162910173 19:13843872-13843894 CGGGACATGCCCAAGGAGACTGG - Intergenic
1163180202 19:15593955-15593977 CTGGACATGCCTTGGGAGGCTGG + Intergenic
1164629044 19:29749190-29749212 CTGGAGAAGGACACAGAGGCAGG - Intergenic
1165435073 19:35790930-35790952 CTGCCCATGGCCACGGAGGCTGG + Intergenic
1165736280 19:38178057-38178079 CTGCACAAGCACACACAGGCAGG - Intronic
1166709934 19:44930354-44930376 CTGGGCATACGCAGGGAGGCTGG + Intergenic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1168605918 19:57759820-57759842 GTGCACATGCACACGCATGCTGG - Intergenic
925342984 2:3149553-3149575 CTGGGCATGCCCACGGGGGCCGG - Intergenic
926005935 2:9373523-9373545 CTGGACATGCCACTGGAGGCAGG - Intronic
926043532 2:9693250-9693272 CTGGACAGGCATCAGGAGGCTGG + Intergenic
926660010 2:15454631-15454653 ATGTACATGCACACGGAATCCGG - Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927678033 2:25121346-25121368 CTGCACAAACACACGGGGGCGGG - Intronic
927906545 2:26862734-26862756 CTGGACCTCCACACAGAGGCTGG - Intronic
932823486 2:74920801-74920823 CTGGACATTGAGAGGGAGGCAGG - Intergenic
934606273 2:95697858-95697880 CTGGACATACACTGGGATGCTGG + Intergenic
940612457 2:156007406-156007428 CTGCACTTGCACATGGAGGGTGG - Intergenic
941806393 2:169715357-169715379 CTGGACTTGCACACCATGGCTGG - Intronic
942664548 2:178303769-178303791 CTGGACATGGTCGGGGAGGCAGG - Intronic
943369821 2:187002610-187002632 CTGGACTTGCTCACCCAGGCGGG - Intergenic
947557416 2:231107706-231107728 CTGGACAAGCATACATAGGCAGG + Intronic
948138962 2:235659069-235659091 GTGGACTTGCAAAAGGAGGCTGG - Intronic
1169154238 20:3315890-3315912 CTGGACATGGACATGGTGGAAGG - Intronic
1170512574 20:17093873-17093895 CTGGACGTGCACACAGTGGCAGG + Intergenic
1172494234 20:35367271-35367293 CTGTAGAAGCACACGGAAGCTGG - Intronic
1173802326 20:45902258-45902280 CTGGACCTGCGCAGGTAGGCAGG - Exonic
1173951653 20:46998182-46998204 CTGGACAGACACACTGAGGGTGG - Intronic
1174103209 20:48143043-48143065 AGGGACATGCACTTGGAGGCAGG + Intergenic
1175530443 20:59671252-59671274 CTGTACATTCACAAGAAGGCTGG + Intronic
1176879486 21:14173749-14173771 CTGGGCATGTACACTGAGGCTGG + Intronic
1183207095 22:36426885-36426907 GTGGAAATGCACTCGGAAGCCGG - Intergenic
1184963273 22:47947280-47947302 CTGGCAATGAACACGGAAGCTGG + Intergenic
1185078500 22:48696168-48696190 CTGCACACCCACACTGAGGCTGG + Intronic
1185286268 22:50001183-50001205 CTGGACATGGACACGGGGCGTGG + Exonic
952071454 3:29642075-29642097 CTGAACATGCACGCTGTGGCAGG + Intronic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954107631 3:48417956-48417978 CTGGGCATGGTCACGGTGGCTGG - Exonic
954389833 3:50262892-50262914 GAGGACAGGCACAGGGAGGCGGG - Intergenic
956749961 3:72337461-72337483 GTGCACATGCACACGGTGTCTGG + Intergenic
959085627 3:101849107-101849129 CTGGGCCTGCAGAGGGAGGCGGG - Intronic
959162409 3:102737944-102737966 CTGGACTTGCACACCATGGCTGG + Intergenic
960864466 3:122185057-122185079 CAGGAAATACACATGGAGGCTGG - Intronic
961444174 3:126971320-126971342 CTGGGAATGCACACAGAGGAAGG + Intergenic
961461586 3:127053467-127053489 CTGGGCATGCACACCAAGGATGG - Intergenic
961492122 3:127263506-127263528 CTGGACAGGGATACTGAGGCAGG - Intergenic
961816400 3:129552889-129552911 CAGGACATGCTCACAGAGGGAGG + Intergenic
962326125 3:134433740-134433762 CTGGACAGAGATACGGAGGCAGG - Intergenic
963749977 3:149167110-149167132 CAGAACATGGACACTGAGGCCGG - Exonic
963835582 3:150055209-150055231 CAGGATATGCTCACTGAGGCTGG + Intergenic
964319401 3:155479369-155479391 CTGGACAGGCACTGGGAGTCTGG - Intronic
968438847 4:611297-611319 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438857 4:611365-611387 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438869 4:611433-611455 CTTCACCTGCACACAGAGGCTGG + Intergenic
968438881 4:611501-611523 CTTCACCTGCACACAGAGGCTGG + Intergenic
969224634 4:5787468-5787490 CTGGACTTGAAGACGGAGGAAGG + Intronic
969876609 4:10140070-10140092 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
969876613 4:10140089-10140111 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
969876617 4:10140108-10140130 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
969876621 4:10140127-10140149 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
975611503 4:76208512-76208534 CTGGAAAGTCACACTGAGGCGGG + Intronic
976933793 4:90603246-90603268 CTGGACGTGCAGACAGAGCCAGG + Intronic
980135886 4:128858151-128858173 CTGGATATGCAAAAGCAGGCAGG - Intronic
984554618 4:181198987-181199009 TTTGACATGCTCACAGAGGCAGG + Intergenic
985344281 4:188986630-188986652 ATGGGCATGCAGAGGGAGGCAGG - Intergenic
985995817 5:3596286-3596308 CTGGGCATGTACGCGGCGGCGGG + Exonic
985996801 5:3601417-3601439 CTGGACAGGCACACAGCAGCAGG - Intergenic
986428904 5:7662494-7662516 CTGGCCATGCAGAGAGAGGCAGG - Intronic
992686692 5:79206272-79206294 CTGGAAATGGAGACGGAGACAGG - Intronic
995597443 5:113763170-113763192 CTGGACATGCAGTTGCAGGCTGG + Intergenic
996978093 5:129459546-129459568 CTCTACCTGCACACGGGGGCAGG + Intergenic
999326750 5:150648822-150648844 CTGGACATGAAATCTGAGGCTGG - Exonic
999708875 5:154298743-154298765 CTGAAAATGTACAGGGAGGCAGG - Intronic
1001703297 5:173722920-173722942 GTGCACATGCACACGCATGCAGG - Intergenic
1001982055 5:176044481-176044503 CTGGACATCCACTTGGAGCCTGG + Intergenic
1002235407 5:177799576-177799598 CTGGACATCCACTTGGAGCCTGG - Intergenic
1002325043 5:178399096-178399118 AAGGTCATGCACACGGATGCTGG + Intronic
1003436206 6:6090866-6090888 CTGGACATACACACTCAGGTGGG + Intergenic
1004732072 6:18367785-18367807 CTGGACCTGCTCACCCAGGCGGG - Intergenic
1005269225 6:24145692-24145714 CTGGACATGTACAAGCTGGCAGG + Exonic
1005965512 6:30723775-30723797 CTGGCCAGGGAAACGGAGGCAGG - Exonic
1006990754 6:38212817-38212839 TTGGACAGCCACACGGAGCCAGG - Intronic
1008332304 6:50259843-50259865 GTGAACATCCACACAGAGGCAGG - Intergenic
1009508765 6:64520657-64520679 CTGGATATGCACATTGAGTCAGG + Intronic
1011013175 6:82724829-82724851 CTGGACAACCTCAAGGAGGCGGG + Intergenic
1011477485 6:87762346-87762368 CTGGACCTGCTGACAGAGGCAGG - Intergenic
1011674484 6:89718867-89718889 CTGGTCTTGCCCACAGAGGCTGG + Exonic
1013939446 6:115644406-115644428 CTGGACATGCAAAAGGTGTCTGG + Intergenic
1017048141 6:150366199-150366221 CTGCACATGCTCATGGAGGCAGG - Intergenic
1018733188 6:166668675-166668697 CTGAAGAGGCACAGGGAGGCTGG + Intronic
1018915366 6:168129521-168129543 CTGGTCAGGCGCGCGGAGGCAGG - Intergenic
1018916406 6:168135130-168135152 CTGTACATACACACCCAGGCTGG - Intergenic
1022039350 7:26565417-26565439 CTTGACCTGCACACTGAGGATGG + Intergenic
1023594615 7:41815701-41815723 CTGGTCATGCACAGGGGAGCTGG - Intergenic
1024198327 7:47081804-47081826 CTGTGCATGCACACAGAGACTGG + Intergenic
1025843760 7:65176736-65176758 ATGGAAAAGCACAGGGAGGCCGG - Intergenic
1027052447 7:75028732-75028754 CTGGAGATGCCCATGGAGGAAGG - Intronic
1029672039 7:102039993-102040015 CAGGACGTGCTCTCGGAGGCTGG + Intronic
1032019354 7:128398433-128398455 CTGGACCTGCTCACCCAGGCGGG - Exonic
1032286347 7:130540833-130540855 CTGGACATGGACCCCCAGGCAGG + Intronic
1033598637 7:142873775-142873797 ATGGACATGCACGCAGAGCCCGG - Intronic
1035394717 7:158527360-158527382 CTGGACACGGAGACGCAGGCTGG - Intronic
1035467114 7:159086717-159086739 CTGGGCAGGCGCTCGGAGGCAGG - Intronic
1035868184 8:3108100-3108122 CTGCACATGGACAGGGAGCCAGG - Intronic
1038685952 8:29718710-29718732 CTGGACTCCCACAAGGAGGCCGG + Intergenic
1039220084 8:35320718-35320740 CTGGACATCCAAAGGGAGGAGGG + Intronic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1042711266 8:71719975-71719997 GTGGACATGAAGTCGGAGGCGGG + Intergenic
1046616970 8:116488472-116488494 CAGAAGGTGCACACGGAGGCAGG + Intergenic
1047275346 8:123401350-123401372 CTGGACCTGCTCACCCAGGCGGG + Intronic
1047748991 8:127866049-127866071 CTGGCCAGGCAGCCGGAGGCAGG - Intergenic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1049632649 8:143666925-143666947 ATGTACATGCACACGGAGGAGGG - Intergenic
1049665256 8:143840168-143840190 CTAGCCATGGACACGGAGGAGGG - Exonic
1051509610 9:17862922-17862944 CTGCACACGCACACGGAAACAGG - Intergenic
1053878619 9:42568665-42568687 CTGCACATGCTCAGTGAGGCCGG + Intergenic
1053894047 9:42725713-42725735 CTGCACATGCTCAGTGAGGCCGG - Intergenic
1054233071 9:62533030-62533052 CTGCACATGCTCAGTGAGGCCGG - Intergenic
1057500759 9:95595212-95595234 CTGGGCCTGAACACAGAGGCTGG - Intergenic
1058184266 9:101835808-101835830 CCGGATATGCACATGAAGGCAGG - Intergenic
1061245313 9:129398582-129398604 CTGGAAATGCACACGGGGTAGGG - Intergenic
1061496226 9:130976120-130976142 GTGGACCTGCACACCCAGGCAGG - Intergenic
1061817936 9:133207470-133207492 GTGGACCCGGACACGGAGGCAGG + Intronic
1062242463 9:135547703-135547725 ATGGACCCGGACACGGAGGCAGG - Intronic
1185634717 X:1543311-1543333 CTGGACATTCAGACGGAAGAGGG + Intergenic
1189659182 X:43278850-43278872 CTGGACCTGCTCACTCAGGCGGG - Intergenic
1190341890 X:49303618-49303640 GTGGACATGCGCACTGAGGCGGG - Intergenic
1190344107 X:49322009-49322031 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190345201 X:49331554-49331576 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190346295 X:49341120-49341142 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190347547 X:49532149-49532171 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190348648 X:49541705-49541727 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190349749 X:49551261-49551283 GTGAACATGCGCACTGAGGCGGG - Exonic
1190350853 X:49560814-49560836 GTGAACATGCGCACTGAGGCGGG - Intronic
1190351954 X:49570372-49570394 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190353055 X:49579921-49579943 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190354156 X:49589468-49589490 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190355258 X:49598992-49599014 GTGAACATGCGCACTGAGGCGGG - Intronic
1190629265 X:52369042-52369064 GTGAACATGCACACTGAGGCAGG - Exonic
1190650363 X:52563260-52563282 GTGAACATGCGCACTGAGGCAGG + Intergenic
1192106825 X:68325870-68325892 CGGGAGATGGACACGGAGACTGG - Intronic
1192332751 X:70190876-70190898 CTGTCCATGCCCATGGAGGCAGG + Intronic
1193908003 X:87265693-87265715 CTGGACATGCTCCCAGAGGAAGG + Intergenic
1197820446 X:130536225-130536247 CTGAATATGCCCACGCAGGCAGG + Intergenic
1198487848 X:137106312-137106334 CAGTACATGCACTAGGAGGCAGG + Intergenic
1199137114 X:144266331-144266353 CTGAACACCCACACAGAGGCTGG + Intergenic