ID: 1133348168

View in Genome Browser
Species Human (GRCh38)
Location 16:5084028-5084050
Sequence CTGCGGTTGAGGAAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 8, 3: 9, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133348159_1133348168 9 Left 1133348159 16:5083996-5084018 CCACAAATGATGCTGGAGCTGGG 0: 1
1: 8
2: 3
3: 19
4: 207
Right 1133348168 16:5084028-5084050 CTGCGGTTGAGGAAGTGATCAGG 0: 1
1: 0
2: 8
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133348168 Original CRISPR CTGCGGTTGAGGAAGTGATC AGG Intronic
901952034 1:12756979-12757001 CTGAGGATGAGGGAGTCATCTGG - Intronic
905471027 1:38191807-38191829 CTGGGGATGAGGCAGGGATCTGG - Intergenic
907486611 1:54782364-54782386 CTGACCTTGAGGAAGTGGTCAGG - Exonic
910072691 1:83238019-83238041 CTGCAGTTGAGGATATGAACTGG + Intergenic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
1065696547 10:28385862-28385884 CTGCTTTAGAGAAAGTGATCGGG + Intergenic
1068280743 10:54865598-54865620 CACCTGTTGAGGAAGTGATCTGG - Intronic
1077579550 11:3407968-3407990 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1078220067 11:9344324-9344346 CTGCTGTTGCTGAAGGGATCAGG + Intergenic
1079097461 11:17520179-17520201 CTGGGGTTGAGAAGGTGGTCAGG + Intronic
1080953298 11:37062678-37062700 CTGGGGAAGAGGAAGAGATCAGG + Intergenic
1081237418 11:40662237-40662259 ATGGGCTTCAGGAAGTGATCTGG - Intronic
1084236575 11:67791506-67791528 CTGCAGTTTCGGAAGTGATCAGG + Intergenic
1084835852 11:71801487-71801509 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
1085784105 11:79436840-79436862 CTGTGGTGGGGGAAGGGATCAGG - Intronic
1089150674 11:116361428-116361450 GAGTGGTTGAGGAAGTGGTCTGG + Intergenic
1089781148 11:120874109-120874131 CTGCGGTGCAGGAACTGAACCGG + Exonic
1090795918 11:130135597-130135619 CTGAGATTGAGGCAGTGAACTGG - Exonic
1091201650 11:133785145-133785167 CTGCGGGTGAGGAACGGGTCAGG - Intergenic
1092407474 12:8230916-8230938 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1092986735 12:13852924-13852946 CTGAGGCTGAGGAGGTGCTCCGG - Intronic
1094502941 12:31036682-31036704 CAGCCTTTGAGGCAGTGATCTGG + Intergenic
1102237674 12:111304321-111304343 ATGGGGTTGGGGAAGTGAGCAGG + Intronic
1103048925 12:117762310-117762332 CGGTGGCTGAGGAAGTGGTCAGG - Intronic
1105811302 13:23998164-23998186 CTGCTGTTGAGAAAGTGAAATGG - Intronic
1106019685 13:25902794-25902816 CTGTGGTTCAGGAAGAGGTCTGG - Intronic
1110425895 13:75366313-75366335 TTGCTCTTGAGGAAGTTATCTGG - Intronic
1110792194 13:79598840-79598862 CTGTGGTTGAAGAAATGACCAGG - Intergenic
1111379467 13:87427824-87427846 CTGTGGTTGAGTAAATAATCTGG + Intergenic
1113041798 13:106111508-106111530 CTGAGGTTGATGAAGCGAGCTGG + Intergenic
1116427645 14:44809839-44809861 CTAAGGTTCAGGAATTGATCAGG + Intergenic
1121999869 14:98638223-98638245 CTGCCATAGAGGAGGTGATCCGG - Intergenic
1122320343 14:100851637-100851659 CTGGGGTTGCAGAAGTGGTCCGG + Intergenic
1125747879 15:42009567-42009589 CTGAGGCTGGGGAAGTGAGCAGG - Intronic
1129733476 15:77945074-77945096 ATGCGCTTGAAGAAGTTATCTGG - Intergenic
1133348168 16:5084028-5084050 CTGCGGTTGAGGAAGTGATCAGG + Intronic
1133975483 16:10597322-10597344 GCGCTGTTGAGGCAGTGATCTGG + Intergenic
1135305454 16:21364031-21364053 CAGAGTTTGAGGAAGTGCTCCGG - Intergenic
1135692875 16:24557934-24557956 GTGAAGTTGAGGAAGTGAGCAGG - Intronic
1136284514 16:29233265-29233287 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1142089549 16:88202778-88202800 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1144804206 17:17953448-17953470 CTGAGGTGGGGAAAGTGATCCGG - Intronic
1149414371 17:56443517-56443539 CTGCGGGTGAGGAAGGGAAGAGG - Intronic
1150294771 17:64001870-64001892 CTGAGGTTGAGGGAGTGAGAAGG - Exonic
1160042793 18:75360802-75360824 CTGGGGTGGAGGAGGTGAGCAGG + Intergenic
1161325630 19:3662387-3662409 CTGCAGATGTGAAAGTGATCTGG - Intronic
1162065639 19:8123761-8123783 GTGCGGTTGGGGAAGGGGTCAGG - Intronic
1163155634 19:15438709-15438731 ATGCCGTTGTGGAAGCGATCGGG + Intronic
1166542571 19:43615086-43615108 CTGGGGTTGGGGAAGTGTTATGG + Intronic
1168374186 19:55861652-55861674 CTGAGGTTGAGCAACTGCTCTGG - Intronic
928942517 2:36741107-36741129 TTGGGAGTGAGGAAGTGATCTGG + Intronic
930596680 2:53398129-53398151 CTGAGGTTGAGGAGGTGCCCAGG - Intergenic
941248906 2:163136912-163136934 CTGGGGTTAAGCAAGTCATCTGG - Intergenic
942645445 2:178105766-178105788 GAGGGGTGGAGGAAGTGATCTGG - Intronic
944187657 2:196967299-196967321 CTGCGGTTGGGGAAGGGAAAGGG - Intronic
948391817 2:237617174-237617196 CTGCGGTTGAGTGATTGATAAGG + Intergenic
948786458 2:240355403-240355425 CTGAGGTTGAGGAAGGGACAGGG - Intergenic
1168881888 20:1213266-1213288 CTGCCGTTGACAGAGTGATCTGG + Intergenic
1169489544 20:6059301-6059323 CTGCCTGTGAGGAAATGATCTGG + Intergenic
1169769277 20:9183332-9183354 CTGGGGAGGAGGAAGTGATGAGG + Intronic
1172102713 20:32495179-32495201 CTGTGGCTGAGGAAGTGCCCAGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1176130893 20:63496386-63496408 CTCTGGTTGAGGAAGGGATCTGG - Intronic
1177445902 21:21196216-21196238 CTGCGGTTGAGGCAGTCCTTAGG - Intronic
1178274699 21:31226438-31226460 CTAGGGTTGGGGAAGTGGTCAGG + Intronic
1178503417 21:33144372-33144394 CTGCTCTTGAGGAAGGGCTCTGG - Intergenic
1179384002 21:40924839-40924861 CAGCTGTGGAGGAAGTGACCAGG + Intergenic
953939467 3:47079403-47079425 ATGCTGTTTAGGAAGTGATTTGG - Intronic
957052517 3:75421290-75421312 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
961214273 3:125147563-125147585 CTGCGGATGAGGAGGGGATCCGG - Intronic
961302325 3:125930264-125930286 CTGCAGTTTAGGAAGTGATCAGG - Intronic
961886134 3:130097521-130097543 CTGCAGTTTAGGAAGTGATCAGG + Intronic
962198294 3:133381199-133381221 CTGGGGTTGAGCCAGTGATGTGG - Intronic
962906979 3:139812831-139812853 CAGCAGTTGTGGAAGTGATCAGG + Intergenic
968974784 4:3816405-3816427 CTGCGTTTGAGCCAGTGCTCAGG + Intergenic
968995327 4:3941672-3941694 CTGCAGTTTAGGAAGTGAGCAGG + Intergenic
969027891 4:4189166-4189188 GGGTGGTTGAGGAAGTGAGCAGG - Intronic
969248435 4:5951805-5951827 CTGGGGTTGGGGAAGAGGTCTGG - Intronic
969758668 4:9167128-9167150 CTGCAGTTTAGGAAGTTGTCAGG - Intergenic
969818632 4:9704591-9704613 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
972821185 4:42703671-42703693 CTGTGGTTGAGTAAGTGGTTTGG + Intergenic
976515013 4:85955131-85955153 CTGCTGTTTAGAAAGAGATCTGG - Intronic
978992095 4:115096978-115097000 GTGCGGTTGAGGGGATGATCAGG - Intronic
981936227 4:150242722-150242744 CAGAGGCTGAGGAAGTGCTCGGG - Intronic
985768552 5:1794984-1795006 CAGCGATGGTGGAAGTGATCGGG - Intergenic
986480480 5:8181735-8181757 GAGCAGTTGAGGAAGTGAGCAGG + Intergenic
986790234 5:11152596-11152618 CTGGGTGGGAGGAAGTGATCTGG + Intronic
996400789 5:123060101-123060123 CAGCTGTTGAGGGAGTGAGCAGG + Intergenic
997708876 5:135986247-135986269 CTGTGGCTGAGGGACTGATCTGG - Intergenic
998783100 5:145680399-145680421 CTGTGGTTGTGGCAGGGATCAGG - Intronic
1002679199 5:180948165-180948187 CTGGGGTGGAGCAAGAGATCAGG - Intronic
1002685072 5:181003666-181003688 CTGGGGTGGAGCAAGAGATCAGG - Intronic
1004793966 6:19060474-19060496 TTGGTGTTGAGCAAGTGATCAGG + Intergenic
1006262011 6:32882608-32882630 CAGTGGTTAAGGAAGTGATGGGG + Intergenic
1010259487 6:73798837-73798859 CTGCCGTTGTTGATGTGATCTGG + Intronic
1012198286 6:96372707-96372729 CTGTGGTTCAGGAAGTGAACAGG + Intergenic
1016801523 6:148173765-148173787 CTGGGGTTGCTCAAGTGATCTGG - Intergenic
1016986887 6:149901691-149901713 CTGTGGATGAGGAAGGCATCAGG - Intergenic
1018188297 6:161286940-161286962 CTGCGGGAGAGGGAGTGGTCTGG + Intergenic
1018229414 6:161661483-161661505 CTGCGGTCTAGGAGGTGGTCAGG - Intronic
1019734396 7:2643713-2643735 GCGCCGCTGAGGAAGTGATCTGG + Intronic
1020319599 7:6929989-6930011 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1027290268 7:76700819-76700841 CTGCAGTTGAGGATATGAACTGG + Intergenic
1027290413 7:76703174-76703196 CTGCAGTTGAGGATATGAACTGG + Intergenic
1027389102 7:77687970-77687992 CTGTGGTTGAGCAAGTGGTTAGG + Intergenic
1033975740 7:147098466-147098488 CTGGGGTTGTGGAAGTAATGGGG - Intronic
1035870364 8:3130772-3130794 CTGCTGTGGAGGAAATGATTGGG - Intronic
1038404609 8:27311875-27311897 CTGTGGTTGAAAAAGTGAACAGG + Intronic
1043775074 8:84256578-84256600 CTGTGGTAGAGCAAGTGAACTGG + Intronic
1048022274 8:130550197-130550219 GTGAGGTTTAGGAGGTGATCAGG + Intergenic
1049733830 8:144192798-144192820 CTGCTGGAGAGGAAGTGATGTGG + Intronic
1050032936 9:1405413-1405435 CTGAGGTTGAGGATTTAATCAGG - Intergenic
1052047910 9:23815941-23815963 CTGCTGTTGAGTTAGTGATGTGG - Intronic
1053426117 9:38011212-38011234 CTCCTGTTGAGGCAGTGATCAGG - Intronic
1058179386 9:101778670-101778692 CTGCAGTTAAGGAATTAATCCGG - Intergenic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1186340408 X:8639911-8639933 ATGCGGTGGAGGCAGTGATCAGG - Intronic
1188899426 X:35711546-35711568 GTGCCTTTGAGGAAGAGATCTGG + Intergenic
1196498312 X:116348436-116348458 CAGCTGTTGAGGGAGGGATCAGG - Intergenic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic