ID: 1133352498

View in Genome Browser
Species Human (GRCh38)
Location 16:5110960-5110982
Sequence TGGGATGCCCCTACCCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133352498_1133352505 13 Left 1133352498 16:5110960-5110982 CCAGTTTGGGTAGGGGCATCCCA No data
Right 1133352505 16:5110996-5111018 CCACAATATCAAACTTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133352498 Original CRISPR TGGGATGCCCCTACCCAAAC TGG (reversed) Intergenic
No off target data available for this crispr