ID: 1133359961

View in Genome Browser
Species Human (GRCh38)
Location 16:5166391-5166413
Sequence ACAGCTGGTGGGTCTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133359961_1133359968 15 Left 1133359961 16:5166391-5166413 CCAGCTTGAGACCCACCAGCTGT No data
Right 1133359968 16:5166429-5166451 GGTGCCACCGTCAGAGATATAGG No data
1133359961_1133359966 -6 Left 1133359961 16:5166391-5166413 CCAGCTTGAGACCCACCAGCTGT No data
Right 1133359966 16:5166408-5166430 AGCTGTAAGTCGGAATCACCTGG No data
1133359961_1133359972 29 Left 1133359961 16:5166391-5166413 CCAGCTTGAGACCCACCAGCTGT No data
Right 1133359972 16:5166443-5166465 AGATATAGGTGAGCAGTCGGTGG No data
1133359961_1133359971 26 Left 1133359961 16:5166391-5166413 CCAGCTTGAGACCCACCAGCTGT No data
Right 1133359971 16:5166440-5166462 CAGAGATATAGGTGAGCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133359961 Original CRISPR ACAGCTGGTGGGTCTCAAGC TGG (reversed) Intergenic
No off target data available for this crispr