ID: 1133362288

View in Genome Browser
Species Human (GRCh38)
Location 16:5183999-5184021
Sequence CAGTGGGTGTGGTGTGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133362284_1133362288 1 Left 1133362284 16:5183975-5183997 CCAGAGGATCACACACTGATCTC No data
Right 1133362288 16:5183999-5184021 CAGTGGGTGTGGTGTGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133362288 Original CRISPR CAGTGGGTGTGGTGTGACAA TGG Intergenic
No off target data available for this crispr