ID: 1133365206

View in Genome Browser
Species Human (GRCh38)
Location 16:5203715-5203737
Sequence CATCAGAAGGAGACCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133365198_1133365206 13 Left 1133365198 16:5203679-5203701 CCGAGATGGCAGCAGTACCGTCC 0: 125
1: 829
2: 365
3: 139
4: 530
Right 1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG No data
1133365202_1133365206 -8 Left 1133365202 16:5203700-5203722 CCAGCTTCGGCTCGGCATCAGAA No data
Right 1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG No data
1133365201_1133365206 -4 Left 1133365201 16:5203696-5203718 CCGTCCAGCTTCGGCTCGGCATC 0: 39
1: 92
2: 48
3: 5
4: 132
Right 1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133365206 Original CRISPR CATCAGAAGGAGACCGTGGA GGG Intergenic
No off target data available for this crispr