ID: 1133368032

View in Genome Browser
Species Human (GRCh38)
Location 16:5226460-5226482
Sequence CTTCTACTGCCAAAAAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133368032_1133368044 21 Left 1133368032 16:5226460-5226482 CCCCTCCTTTTTGGCAGTAGAAG No data
Right 1133368044 16:5226504-5226526 AAACTGGAGCAGCTTGCCCAAGG No data
1133368032_1133368041 5 Left 1133368032 16:5226460-5226482 CCCCTCCTTTTTGGCAGTAGAAG No data
Right 1133368041 16:5226488-5226510 GTGGCTAGAACCCAAGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133368032 Original CRISPR CTTCTACTGCCAAAAAGGAG GGG (reversed) Intergenic
No off target data available for this crispr