ID: 1133368044

View in Genome Browser
Species Human (GRCh38)
Location 16:5226504-5226526
Sequence AAACTGGAGCAGCTTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133368035_1133368044 19 Left 1133368035 16:5226462-5226484 CCTCCTTTTTGGCAGTAGAAGGG No data
Right 1133368044 16:5226504-5226526 AAACTGGAGCAGCTTGCCCAAGG No data
1133368032_1133368044 21 Left 1133368032 16:5226460-5226482 CCCCTCCTTTTTGGCAGTAGAAG No data
Right 1133368044 16:5226504-5226526 AAACTGGAGCAGCTTGCCCAAGG No data
1133368037_1133368044 16 Left 1133368037 16:5226465-5226487 CCTTTTTGGCAGTAGAAGGGTGG No data
Right 1133368044 16:5226504-5226526 AAACTGGAGCAGCTTGCCCAAGG No data
1133368033_1133368044 20 Left 1133368033 16:5226461-5226483 CCCTCCTTTTTGGCAGTAGAAGG No data
Right 1133368044 16:5226504-5226526 AAACTGGAGCAGCTTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133368044 Original CRISPR AAACTGGAGCAGCTTGCCCA AGG Intergenic
No off target data available for this crispr