ID: 1133369855

View in Genome Browser
Species Human (GRCh38)
Location 16:5239450-5239472
Sequence CTGTGTCTTGCATGATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133369855_1133369861 5 Left 1133369855 16:5239450-5239472 CCTCCAAATCATGCAAGACACAG No data
Right 1133369861 16:5239478-5239500 GAGCAAAGACAAGGTGGCTGTGG No data
1133369855_1133369860 -1 Left 1133369855 16:5239450-5239472 CCTCCAAATCATGCAAGACACAG No data
Right 1133369860 16:5239472-5239494 GGGTAAGAGCAAAGACAAGGTGG No data
1133369855_1133369863 25 Left 1133369855 16:5239450-5239472 CCTCCAAATCATGCAAGACACAG No data
Right 1133369863 16:5239498-5239520 TGGCCCATGTCCACCCTCTCGGG No data
1133369855_1133369862 24 Left 1133369855 16:5239450-5239472 CCTCCAAATCATGCAAGACACAG No data
Right 1133369862 16:5239497-5239519 GTGGCCCATGTCCACCCTCTCGG No data
1133369855_1133369859 -4 Left 1133369855 16:5239450-5239472 CCTCCAAATCATGCAAGACACAG No data
Right 1133369859 16:5239469-5239491 ACAGGGTAAGAGCAAAGACAAGG No data
1133369855_1133369864 26 Left 1133369855 16:5239450-5239472 CCTCCAAATCATGCAAGACACAG No data
Right 1133369864 16:5239499-5239521 GGCCCATGTCCACCCTCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133369855 Original CRISPR CTGTGTCTTGCATGATTTGG AGG (reversed) Intergenic
No off target data available for this crispr