ID: 1133370223

View in Genome Browser
Species Human (GRCh38)
Location 16:5240760-5240782
Sequence ACGTGGGCCCCTGAGTGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133370216_1133370223 2 Left 1133370216 16:5240735-5240757 CCTGTGAGCTCCCGGTGTCCTGC No data
Right 1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG No data
1133370211_1133370223 26 Left 1133370211 16:5240711-5240733 CCTTGCATCCCTCGGGGCGCTGT No data
Right 1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG No data
1133370213_1133370223 17 Left 1133370213 16:5240720-5240742 CCTCGGGGCGCTGTCCCTGTGAG No data
Right 1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG No data
1133370220_1133370223 -9 Left 1133370220 16:5240746-5240768 CCGGTGTCCTGCACACGTGGGCC No data
Right 1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG No data
1133370219_1133370223 -8 Left 1133370219 16:5240745-5240767 CCCGGTGTCCTGCACACGTGGGC No data
Right 1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG No data
1133370212_1133370223 18 Left 1133370212 16:5240719-5240741 CCCTCGGGGCGCTGTCCCTGTGA No data
Right 1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG No data
1133370215_1133370223 3 Left 1133370215 16:5240734-5240756 CCCTGTGAGCTCCCGGTGTCCTG No data
Right 1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133370223 Original CRISPR ACGTGGGCCCCTGAGTGACC GGG Intergenic
No off target data available for this crispr