ID: 1133370616

View in Genome Browser
Species Human (GRCh38)
Location 16:5243138-5243160
Sequence GCTGTGGGTCAGACACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133370616_1133370619 -10 Left 1133370616 16:5243138-5243160 CCAGGGTGTGTCTGACCCACAGC No data
Right 1133370619 16:5243151-5243173 GACCCACAGCTGTTCCTGGAGGG No data
1133370616_1133370623 10 Left 1133370616 16:5243138-5243160 CCAGGGTGTGTCTGACCCACAGC No data
Right 1133370623 16:5243171-5243193 GGGAGAGAGAAGTCTCTCCTAGG No data
1133370616_1133370624 17 Left 1133370616 16:5243138-5243160 CCAGGGTGTGTCTGACCCACAGC No data
Right 1133370624 16:5243178-5243200 AGAAGTCTCTCCTAGGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133370616 Original CRISPR GCTGTGGGTCAGACACACCC TGG (reversed) Intergenic
No off target data available for this crispr