ID: 1133370831

View in Genome Browser
Species Human (GRCh38)
Location 16:5244455-5244477
Sequence TACCCAGTTCACTCCCATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133370821_1133370831 23 Left 1133370821 16:5244409-5244431 CCAGGATTCCAGGAGGCAGGGAT No data
Right 1133370831 16:5244455-5244477 TACCCAGTTCACTCCCATACTGG No data
1133370824_1133370831 15 Left 1133370824 16:5244417-5244439 CCAGGAGGCAGGGATGTGGGCAG No data
Right 1133370831 16:5244455-5244477 TACCCAGTTCACTCCCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133370831 Original CRISPR TACCCAGTTCACTCCCATAC TGG Intergenic
No off target data available for this crispr