ID: 1133374540

View in Genome Browser
Species Human (GRCh38)
Location 16:5273554-5273576
Sequence TTCCCGTCGTTCCAAACCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133374540_1133374543 0 Left 1133374540 16:5273554-5273576 CCCAAGGTTTGGAACGACGGGAA No data
Right 1133374543 16:5273577-5273599 GGAGCTGCCATCTGTGTTTAAGG No data
1133374540_1133374545 10 Left 1133374540 16:5273554-5273576 CCCAAGGTTTGGAACGACGGGAA No data
Right 1133374545 16:5273587-5273609 TCTGTGTTTAAGGTGAGAAGCGG No data
1133374540_1133374548 13 Left 1133374540 16:5273554-5273576 CCCAAGGTTTGGAACGACGGGAA No data
Right 1133374548 16:5273590-5273612 GTGTTTAAGGTGAGAAGCGGGGG No data
1133374540_1133374546 11 Left 1133374540 16:5273554-5273576 CCCAAGGTTTGGAACGACGGGAA No data
Right 1133374546 16:5273588-5273610 CTGTGTTTAAGGTGAGAAGCGGG No data
1133374540_1133374547 12 Left 1133374540 16:5273554-5273576 CCCAAGGTTTGGAACGACGGGAA No data
Right 1133374547 16:5273589-5273611 TGTGTTTAAGGTGAGAAGCGGGG No data
1133374540_1133374549 18 Left 1133374540 16:5273554-5273576 CCCAAGGTTTGGAACGACGGGAA No data
Right 1133374549 16:5273595-5273617 TAAGGTGAGAAGCGGGGGAGTGG No data
1133374540_1133374550 21 Left 1133374540 16:5273554-5273576 CCCAAGGTTTGGAACGACGGGAA No data
Right 1133374550 16:5273598-5273620 GGTGAGAAGCGGGGGAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133374540 Original CRISPR TTCCCGTCGTTCCAAACCTT GGG (reversed) Intergenic
No off target data available for this crispr