ID: 1133374545

View in Genome Browser
Species Human (GRCh38)
Location 16:5273587-5273609
Sequence TCTGTGTTTAAGGTGAGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133374541_1133374545 9 Left 1133374541 16:5273555-5273577 CCAAGGTTTGGAACGACGGGAAG No data
Right 1133374545 16:5273587-5273609 TCTGTGTTTAAGGTGAGAAGCGG No data
1133374540_1133374545 10 Left 1133374540 16:5273554-5273576 CCCAAGGTTTGGAACGACGGGAA No data
Right 1133374545 16:5273587-5273609 TCTGTGTTTAAGGTGAGAAGCGG No data
1133374539_1133374545 11 Left 1133374539 16:5273553-5273575 CCCCAAGGTTTGGAACGACGGGA No data
Right 1133374545 16:5273587-5273609 TCTGTGTTTAAGGTGAGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133374545 Original CRISPR TCTGTGTTTAAGGTGAGAAG CGG Intergenic
No off target data available for this crispr