ID: 1133382849

View in Genome Browser
Species Human (GRCh38)
Location 16:5345627-5345649
Sequence TTTAAGAAGCCCAACGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133382849_1133382855 27 Left 1133382849 16:5345627-5345649 CCGTGCTCGTTGGGCTTCTTAAA No data
Right 1133382855 16:5345677-5345699 GCCATCTCTTTCCGATGCATGGG No data
1133382849_1133382854 26 Left 1133382849 16:5345627-5345649 CCGTGCTCGTTGGGCTTCTTAAA No data
Right 1133382854 16:5345676-5345698 AGCCATCTCTTTCCGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133382849 Original CRISPR TTTAAGAAGCCCAACGAGCA CGG (reversed) Intergenic
No off target data available for this crispr