ID: 1133390507

View in Genome Browser
Species Human (GRCh38)
Location 16:5406326-5406348
Sequence GGTCTGAATAGAACAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133390500_1133390507 11 Left 1133390500 16:5406292-5406314 CCCAGTGTGGGTGAGTGCCATCC No data
Right 1133390507 16:5406326-5406348 GGTCTGAATAGAACAAAAGGTGG No data
1133390499_1133390507 12 Left 1133390499 16:5406291-5406313 CCCCAGTGTGGGTGAGTGCCATC No data
Right 1133390507 16:5406326-5406348 GGTCTGAATAGAACAAAAGGTGG No data
1133390504_1133390507 -10 Left 1133390504 16:5406313-5406335 CCAATCCGTCAAAGGTCTGAATA No data
Right 1133390507 16:5406326-5406348 GGTCTGAATAGAACAAAAGGTGG No data
1133390501_1133390507 10 Left 1133390501 16:5406293-5406315 CCAGTGTGGGTGAGTGCCATCCA No data
Right 1133390507 16:5406326-5406348 GGTCTGAATAGAACAAAAGGTGG No data
1133390503_1133390507 -6 Left 1133390503 16:5406309-5406331 CCATCCAATCCGTCAAAGGTCTG No data
Right 1133390507 16:5406326-5406348 GGTCTGAATAGAACAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133390507 Original CRISPR GGTCTGAATAGAACAAAAGG TGG Intergenic
No off target data available for this crispr