ID: 1133391407

View in Genome Browser
Species Human (GRCh38)
Location 16:5413227-5413249
Sequence GCTGTAACAGTTGGGGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133391407_1133391411 -3 Left 1133391407 16:5413227-5413249 CCAACAGCCCCAACTGTTACAGC No data
Right 1133391411 16:5413247-5413269 AGCTTCTTCTAATATTAACAAGG No data
1133391407_1133391413 28 Left 1133391407 16:5413227-5413249 CCAACAGCCCCAACTGTTACAGC No data
Right 1133391413 16:5413278-5413300 GCATTCTCCAGAGAGCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133391407 Original CRISPR GCTGTAACAGTTGGGGCTGT TGG (reversed) Intergenic