ID: 1133391408

View in Genome Browser
Species Human (GRCh38)
Location 16:5413234-5413256
Sequence AGAAGAAGCTGTAACAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133391408_1133391413 21 Left 1133391408 16:5413234-5413256 CCCCAACTGTTACAGCTTCTTCT No data
Right 1133391413 16:5413278-5413300 GCATTCTCCAGAGAGCACCATGG No data
1133391408_1133391411 -10 Left 1133391408 16:5413234-5413256 CCCCAACTGTTACAGCTTCTTCT No data
Right 1133391411 16:5413247-5413269 AGCTTCTTCTAATATTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133391408 Original CRISPR AGAAGAAGCTGTAACAGTTG GGG (reversed) Intergenic