ID: 1133391409 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:5413235-5413257 |
Sequence | TAGAAGAAGCTGTAACAGTT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1133391409_1133391413 | 20 | Left | 1133391409 | 16:5413235-5413257 | CCCAACTGTTACAGCTTCTTCTA | No data | ||
Right | 1133391413 | 16:5413278-5413300 | GCATTCTCCAGAGAGCACCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1133391409 | Original CRISPR | TAGAAGAAGCTGTAACAGTT GGG (reversed) | Intergenic | ||