ID: 1133391409

View in Genome Browser
Species Human (GRCh38)
Location 16:5413235-5413257
Sequence TAGAAGAAGCTGTAACAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133391409_1133391413 20 Left 1133391409 16:5413235-5413257 CCCAACTGTTACAGCTTCTTCTA No data
Right 1133391413 16:5413278-5413300 GCATTCTCCAGAGAGCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133391409 Original CRISPR TAGAAGAAGCTGTAACAGTT GGG (reversed) Intergenic