ID: 1133391413

View in Genome Browser
Species Human (GRCh38)
Location 16:5413278-5413300
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133391407_1133391413 28 Left 1133391407 16:5413227-5413249 CCAACAGCCCCAACTGTTACAGC No data
Right 1133391413 16:5413278-5413300 GCATTCTCCAGAGAGCACCATGG No data
1133391408_1133391413 21 Left 1133391408 16:5413234-5413256 CCCCAACTGTTACAGCTTCTTCT No data
Right 1133391413 16:5413278-5413300 GCATTCTCCAGAGAGCACCATGG No data
1133391410_1133391413 19 Left 1133391410 16:5413236-5413258 CCAACTGTTACAGCTTCTTCTAA No data
Right 1133391413 16:5413278-5413300 GCATTCTCCAGAGAGCACCATGG No data
1133391409_1133391413 20 Left 1133391409 16:5413235-5413257 CCCAACTGTTACAGCTTCTTCTA No data
Right 1133391413 16:5413278-5413300 GCATTCTCCAGAGAGCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133391413 Original CRISPR GCATTCTCCAGAGAGCACCA TGG Intergenic