ID: 1133394376

View in Genome Browser
Species Human (GRCh38)
Location 16:5434277-5434299
Sequence CTCCCTCTGATGCGTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133394376_1133394379 21 Left 1133394376 16:5434277-5434299 CCAGACACACGCATCAGAGGGAG No data
Right 1133394379 16:5434321-5434343 TTTTTTTTTTTTTTTTTTTGAGG 0: 5644
1: 19016
2: 22217
3: 49735
4: 178307
1133394376_1133394381 26 Left 1133394376 16:5434277-5434299 CCAGACACACGCATCAGAGGGAG No data
Right 1133394381 16:5434326-5434348 TTTTTTTTTTTTTTGAGGCAGGG 0: 803
1: 14764
2: 18397
3: 39449
4: 163102
1133394376_1133394380 25 Left 1133394376 16:5434277-5434299 CCAGACACACGCATCAGAGGGAG No data
Right 1133394380 16:5434325-5434347 TTTTTTTTTTTTTTTGAGGCAGG 0: 833
1: 14576
2: 18633
3: 42286
4: 172953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133394376 Original CRISPR CTCCCTCTGATGCGTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr