ID: 1133394379

View in Genome Browser
Species Human (GRCh38)
Location 16:5434321-5434343
Sequence TTTTTTTTTTTTTTTTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274919
Summary {0: 5644, 1: 19016, 2: 22217, 3: 49735, 4: 178307}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133394375_1133394379 22 Left 1133394375 16:5434276-5434298 CCCAGACACACGCATCAGAGGGA No data
Right 1133394379 16:5434321-5434343 TTTTTTTTTTTTTTTTTTTGAGG 0: 5644
1: 19016
2: 22217
3: 49735
4: 178307
1133394373_1133394379 23 Left 1133394373 16:5434275-5434297 CCCCAGACACACGCATCAGAGGG No data
Right 1133394379 16:5434321-5434343 TTTTTTTTTTTTTTTTTTTGAGG 0: 5644
1: 19016
2: 22217
3: 49735
4: 178307
1133394371_1133394379 27 Left 1133394371 16:5434271-5434293 CCATCCCCAGACACACGCATCAG No data
Right 1133394379 16:5434321-5434343 TTTTTTTTTTTTTTTTTTTGAGG 0: 5644
1: 19016
2: 22217
3: 49735
4: 178307
1133394376_1133394379 21 Left 1133394376 16:5434277-5434299 CCAGACACACGCATCAGAGGGAG No data
Right 1133394379 16:5434321-5434343 TTTTTTTTTTTTTTTTTTTGAGG 0: 5644
1: 19016
2: 22217
3: 49735
4: 178307
1133394377_1133394379 -2 Left 1133394377 16:5434300-5434322 CCATCTCTGCTGAAGTCCTTTTT No data
Right 1133394379 16:5434321-5434343 TTTTTTTTTTTTTTTTTTTGAGG 0: 5644
1: 19016
2: 22217
3: 49735
4: 178307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133394379 Original CRISPR TTTTTTTTTTTTTTTTTTTG AGG Intergenic
Too many off-targets to display for this crispr