ID: 1133394380

View in Genome Browser
Species Human (GRCh38)
Location 16:5434325-5434347
Sequence TTTTTTTTTTTTTTTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249281
Summary {0: 833, 1: 14576, 2: 18633, 3: 42286, 4: 172953}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133394375_1133394380 26 Left 1133394375 16:5434276-5434298 CCCAGACACACGCATCAGAGGGA No data
Right 1133394380 16:5434325-5434347 TTTTTTTTTTTTTTTGAGGCAGG 0: 833
1: 14576
2: 18633
3: 42286
4: 172953
1133394373_1133394380 27 Left 1133394373 16:5434275-5434297 CCCCAGACACACGCATCAGAGGG No data
Right 1133394380 16:5434325-5434347 TTTTTTTTTTTTTTTGAGGCAGG 0: 833
1: 14576
2: 18633
3: 42286
4: 172953
1133394376_1133394380 25 Left 1133394376 16:5434277-5434299 CCAGACACACGCATCAGAGGGAG No data
Right 1133394380 16:5434325-5434347 TTTTTTTTTTTTTTTGAGGCAGG 0: 833
1: 14576
2: 18633
3: 42286
4: 172953
1133394377_1133394380 2 Left 1133394377 16:5434300-5434322 CCATCTCTGCTGAAGTCCTTTTT No data
Right 1133394380 16:5434325-5434347 TTTTTTTTTTTTTTTGAGGCAGG 0: 833
1: 14576
2: 18633
3: 42286
4: 172953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133394380 Original CRISPR TTTTTTTTTTTTTTTGAGGC AGG Intergenic
Too many off-targets to display for this crispr