ID: 1133394381

View in Genome Browser
Species Human (GRCh38)
Location 16:5434326-5434348
Sequence TTTTTTTTTTTTTTGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236515
Summary {0: 803, 1: 14764, 2: 18397, 3: 39449, 4: 163102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133394376_1133394381 26 Left 1133394376 16:5434277-5434299 CCAGACACACGCATCAGAGGGAG No data
Right 1133394381 16:5434326-5434348 TTTTTTTTTTTTTTGAGGCAGGG 0: 803
1: 14764
2: 18397
3: 39449
4: 163102
1133394377_1133394381 3 Left 1133394377 16:5434300-5434322 CCATCTCTGCTGAAGTCCTTTTT No data
Right 1133394381 16:5434326-5434348 TTTTTTTTTTTTTTGAGGCAGGG 0: 803
1: 14764
2: 18397
3: 39449
4: 163102
1133394373_1133394381 28 Left 1133394373 16:5434275-5434297 CCCCAGACACACGCATCAGAGGG No data
Right 1133394381 16:5434326-5434348 TTTTTTTTTTTTTTGAGGCAGGG 0: 803
1: 14764
2: 18397
3: 39449
4: 163102
1133394375_1133394381 27 Left 1133394375 16:5434276-5434298 CCCAGACACACGCATCAGAGGGA No data
Right 1133394381 16:5434326-5434348 TTTTTTTTTTTTTTGAGGCAGGG 0: 803
1: 14764
2: 18397
3: 39449
4: 163102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133394381 Original CRISPR TTTTTTTTTTTTTTGAGGCA GGG Intergenic
Too many off-targets to display for this crispr