ID: 1133402105

View in Genome Browser
Species Human (GRCh38)
Location 16:5495822-5495844
Sequence TTGGCTAAAGAAACCCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133402100_1133402105 5 Left 1133402100 16:5495794-5495816 CCAGGCATCTTCATGAATGTTCC No data
Right 1133402105 16:5495822-5495844 TTGGCTAAAGAAACCCATTAAGG No data
1133402099_1133402105 14 Left 1133402099 16:5495785-5495807 CCTTTTTCTCCAGGCATCTTCAT No data
Right 1133402105 16:5495822-5495844 TTGGCTAAAGAAACCCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133402105 Original CRISPR TTGGCTAAAGAAACCCATTA AGG Intergenic
No off target data available for this crispr